Содержание

зажим проводов: инструкция, как пользоваться

При проведении электромонтажных работ львиную долю времени занимает выполнение соединений проводов в распределительных коробках. Помимо трудоёмкости создания распределительные коробки являются слабым местом любой электропроводки, большая часть неисправностей вызвана именно плохим контактом либо коротким замыканием в них.

Традиционные способы соединения проводов

Исторически соединения выполнялись скруткой или с использованием винтовых клемм. Скрутка проводов – наиболее простой и распространённый способ монтажа, но и он имеет недостатки:

  • Нельзя скручивать вместе медные и алюминиевые провода.
  • Не следует скручивать многожильные провода.
  • Размер скрутки должен быть не менее пяти витков.
  • Нельзя скручивать провода разных сечений.
  • Чтобы скрутка не ослабела с годами, она либо проваривается, либо применяются специальные подпружиненные колпачки, для медных проводов используют также пайку, но это достаточно трудоемко.
  • Необходимо дополнительно изолировать место скрутки.
  • Не рекомендуется соединять более трёх проводов.

Использование винтовых клемм также имеет ограничения вследствие больших габаритов, малого количества соединяемых проводов, ослабевания винтового соединения со временем и конечно трудоёмкости.

Достоинства и недостатки зажимов “Ваго”

Альтернативным способом монтажа является применение быстрозажимных клеммников. Клеммные зажимы “Ваго” имеют целый ряд неоспоримых преимуществ при выполнении электромонтажных работ:

  • Возможность соединения алюминиевых и медных проводов.
  • Соединение проводов разных диаметров от 0,5 до 4,0 кв. мм.
  • Использование многожильных проводов.
  • Номинальный ток до 32А.
  • Соединение до восьми проводов в одной группе.
  • Быстрый и удобный монтаж без применения специальных инструментов.
  • Изолированное электробезопасное соединение.
  • Компактный размер клеммника.
  • Возможность визуального контроля соединения через прозрачный корпус.
  • Отдельные модели позволяют выполнять разборное соединение.
  • Наличие специальных отверстий в корпусе для подключения контрольно-измерительных приборов.

Единственным недостатком этих соединителей является их цена, но он с лихвой окупается экономией времени при монтаже, надёжностью и долговечностью соединения. Также высокой плотности монтажа можно достичь, применяя зажим “Ваго” (фото демонстрирует аккуратность монтажа клеммников в распределительной коробке).

Типы зажимов “Ваго”

Компания выпускает клеммы с зажимными устройствами следующих типов:

  • Пружинные зажимы.
  • Зажимы FIT-CLAMP.
  • Зажимы CAGE CLAMP.

Клеммы с плоскими пружинными зажимами являются наиболее простым и бюджетным решением для соединения проводов. Зажим представляет собой блок из плоских стальных пружин, запрессованных в поликарбонатный корпус. Выпускаются блоки с числом контактов от двух до восьми. Зажим предназначен для одноразового соединения проводов, повторное применение нежелательно, так как усилие пружины ослабевает.

В зажимах FIT-CLAMP используется врезной контакт (IDC), что обеспечивает наиболее быстрый вариант монтажа. Эти устройства позволяют соединять провода без предварительного снятия изоляции.

В клеммах с зажимами CAGE CLAMP стальная пружина выполнена отдельно от токопроводящей медной шины. Для изготовления токопроводящей платины используется луженая медь. Такая конструкция зажима позволяет использовать любые провода, в том числе тонко- и многожильные.

Линейка продукции

Номенклатура клеммных соединителей “Ваго” (зажимы, характеристики которых мы рассматриваем) такова:

  • 294 и 294 Linec – специализированные клеммы для присоединения источников питания и осветительных приборов, предназначены для ответвления трёх проводников: фазы, нуля и защитного заземления.
  • 224 – серия для подключения тонкожильных проводников осветительных приборов к распределительной сети.
  • 243 PUSH WIRE – для присоединения одножильных проводов малых сечений.
  • 2273 COMPACT PUSH WIRE – используются для соединения любых проводов в распределительных коробках.
  • 273 и 773 PUSH WIRE – соединение одножильных проводов в монтажных коробках.
  • 222 – универсальные клеммы для многократного соединения любых проводов с сечением от 0,08 мм кв.
  • 221 WAGO COMPACT – универсальный клеммник уменьшенного габарита для многократного соединения любых проводов с сечением от 0,2 мм кв.

Рассмотрим более подробно зажимы ваго. Как пользоваться клеммами каждой серии?

Соединители серий 294 и 294 Linect

Используемые в клеммниках этих серий зажимы Push-in CAGE CLAMP позволяют подключать одно-, много- и тонкожильные провода без применения специального инструмента. Опционально прямой контакт защитного заземления PE может быть расположен под соединителем и использоваться для объединения с PE шиной при монтаже. На стороне внутреннего соединения имеется полнофункциональный третий контакт для каждого полюса сечением от 0,5 до 0,75 кв. мм. Соответствующий PE-полюс может оснащаться внешним контактом PE (защитное заземление). Для присоединения подключаемого прибора в каждой группе предусмотрен третий зажим с сечением 0,5-0,75 мм кв. Эти зажимы проводов “Ваго” монтируются следующим образом:

  • Распределительная цепь, к которой необходимо параллельно подключить светильник или иную нагрузку, разрезается.
  • С обрезанных концов проводов удаляется изоляция на длину 1 см.
  • Нажать на подвижную часть клеммы и ввести зачищенные провода в открывшееся отверстие соответствующего полюса до упора.
  • Отпустить подвижную часть клеммы ваго, зажим зафиксирует провод.
  • Подключить провода осветительного прибора к самозажимным контактам каждого полюса.

Для удобства монтажа каждый полюс клеммы промаркирован латинскими буквами L, N, PE.

Изделия 224 серии

Этот зажим “Ваго” – для многожильных проводов осветительных приборов или иной слаботочной нагрузки. Тонкий проводник осветительного прибора может быть подключён к концу либо в разрыв распределительной сети. Каждая клемма рассчитана на подключение к одному полюсу электрической сети. Сечение проводов распределительной сети – 1-2,5 мм кв. , а подключаемого прибора – 0,5-2,5 мм кв. каждого полюса сечением от 0,5 до 0,75 мм². Монтаж клеммы производится в такой последовательности:

  • При подключении в разрыв распределительной линии питающий провод разрезается.
  • С обрезанных концов проводов удаляется изоляция на длину 1 см.
  • Провода распределительной сети вставляются в круглые отверстия самозажимных контактов.
  • Нажать на подвижную часть клеммы и ввести зачищенный провод от осветительного прибора в отверстие квадратной формы до упора.
  • Отпустить подвижную часть клеммы, зажим зафиксирует провод.

Клеммы 243 серии

243 серия “Ваго” (зажим PUSH WIRE) применяется для присоединения слаботочных устройств одножильными проводами малых сечений от 0,5 до 0,8 мм кв. Имеют ультракомпактный размер. Выпускаются модели для подключения от трёх до восьми проводов. Номинальное напряжение устройства – до 100В, максимальный ток – до 6А.

Зажимы 273 и 773 серии

Эти серии изделий “Ваго” (зажим PUSH WIRE) предназначены для монтажа одножильных проводов в распределительных коробках и различаются максимальным сечением проводов: до 2,5 мм кв. для 273 серии и до 4 мм кв. для 773-й. Максимально допустимый ток изделий – до 32А.

Зажимы 2273 серии

Клеммы серии 2273 с контактами COMPACT PUSH WIRE отличаются компактным размером, что существенно уплотняет монтаж. Токовая нагрузка этих зажимов – до 24А. Номинальный ряд включает изделия для подключения до восьми проводов. Допускается применение многожильных, алюминиевых либо медных проводов сечением от 0,5 до 2,5 мм кв.

Плоскозажимные клеммы 243, 273, 773 и 2273 серий монтируются вручную без применения специальных инструментов в такой последовательности:

  • Концы проводов зачищаются на длину 10 мм.
  • Зачищенные концы проводов до упора вставляются в отверстия клеммы.
  • Правильность монтажа контролируется через прозрачную крышку корпуса клеммы.

Продукция 222 и 221 серий

Зажимы этих серий различаются размером и типом корпуса. Устройства позволяют выполнять многократный монтаж любых проводов сечением от 0,08 мм для 222 серии и от 0,2 до 4,0 мм кв. (для 221 серии). Выпускаются варианты для подключения двух, трёх и пяти проводов. Максимальный ток зажима – 32А. Серия 221 выпускается в компактном корпусе с прозрачной крышкой.

Монтаж зажимов выполняется вручную:

  • Концы проводов зачищаются на длину 10 мм.
  • Поднимаются рычажки оранжевого цвета на клеммнике “Ваго”, зажим открывает отверстие пружинного контакта.
  • Зачищенные концы проводов до упора вставляются в отверстия клеммы.
  • Рычажки опускаются в исходное положение, отпуская пружину контакта и зажимая провод.
  • Для изделий 221 серии можно проконтролировать качество монтажа через прозрачный корпус.

Общие указания по монтажу

Клеммные зажимы “Ваго” широко применяются по всему миру и доказали свою эффективность. Однако необходимо соблюдать некоторые простые рекомендации при их монтаже:

  • Суммарная нагрузка всех линий, подключаемых к одной клемме, не должна превышать её номинальный ток. Желательно всегда выбирать клемму с запасом по току.
  • Учитывайте паспортные данные изделия – максимальное напряжение, диапазон сечений жил проводов и их тип.
  • Монтаж клемм должен выполняться только в распределительных (монтажных коробках).
  • Распределительные коробки должны располагаться в доступном для ревизии месте.
  • Всегда оставляйте запас проводов, достаточный для повторного монтажа.
  • При зачистке концов проводов используете специальные метки, нанесённые на корпусе клемм. Ровно зачищенные провода позволят правильно выполнить их установку в зажимах.
  • При монтаже алюминиевых проводов используйте специальную пасту, исключающую окисление алюминия.
  • Для контроля напряжения на смонтированных клеммах подключайте измерительный прибор к специально предназначенным отверстиям в корпусах зажимов.

Более 35 лет электромонтажники во всем мире применяют зажимы “Ваго”. Отзывы довольных пользователей о применении этих изделий говорят сами за себя.

Клеммники Wago, характеристики и устройство, как пользоваться

Использование специальных приспособлений под названием клеммники Wago обеспечивает надежное соединение пучков кабеля различных сечений. Зажимы Wago – это наиболее популярный вид современных установочных приспособлений в электротехнике.

Появление на рынке электротоваров популярных клеммников фирмы Ваго, выпускающей контактные системы, вызвало повышенный интерес компаний, занимающихся электромонтажными работами. Электрики особенно оценили надежность контактов и простоту монтажных операций.

Клеммы Wago – это плоско-пружинные зажимы, изготовленные из аустенитно – хромоникелевой стали, имеющей пружинные характеристики, способной создать программируемое усилие. Необходимая сила давления создается автоматически в зависимости от сечения и материала жилы. Плоско-пружинный зажим равномерно давит на всю контактную поверхность, что гарантирует отсутствие высокого переходного сопротивления. Материал несущей рейки – электролитная медь с мягкой луженой поверхностью.

Требования к фирменным устройствам

Изготавливая пружинные клеммы Wago, специалисты компании постоянно придерживаются принципов своей фирмы.

Требования, которым соответствуют клеммники Ваго:

  • безопасность;
  • устойчивость к вибрации;
  • надежность;
  • полученные соединения не требуют дальнейшего обслуживания;
  • отсутствие специальных навыков для выполнения монтажа.

Применение новейших технологий при изготовлении пружинных зажимов способствует соответствию перечисленным требованиям. Действия электрика не нарушают усилия пружинного зажима, с которым прижимается соединяемый провод. Для подключения зачищенного кабеля не требуется использовать дополнительные инструменты. Жилы размещаются в подготовленных гнездах, корпус запирается на защелку.

Виды клеммных приспособлений

В зависимости от способов подключения Wago клеммники подразделяются на следующие категории:

  1. Зажимы Ваго, предназначенные для одноразового использования.
  2. Многоразовые клеммники.
  3. Клеммники Wago, создающие контакт кабелей без снятия изолирующих материалов.

Зажимы, относящиеся к первой категории, используются для разовых электрических соединений, которые не требуют дальнейших разборок. Для подключения достаточно протолкнуть зачищенные концы проводников в соединительный узел до упора, внутренний зажим закусывает жилу и не позволяет выйти. Разбирать полученные контакты не рекомендуется во избежание поломок клемм.

Для создания электрических контактов проводов различных сечений, материалов, конструкций применяются зажимы многократного использования. Эти клеммы универсальны, имеют зажимной механизм оригинальной конструкции, позволяющий фиксировать пучок жил при помощи рычага. Зажим в виде клетки способен создать усилие, достаточное для удержания помещенных в него кабелей. Для отсоединения проводников открывают фиксирующий рычаг или вставляют отвертку для ослабления зажимного механизма.

Клеммники Wago, работающие с изолированными проводами также можно снимать и многократно использовать впоследствии. Корпус устройства оснащен отверстием для вставки специального контрольного штекера 2 мм, чтобы проверить ток в полученной электрической цепи и параметры электросети без нарушения целостности собранного узла.

Важно, при установке клеммная колодка Wago должна располагаться так, чтобы впоследствии к ней был сохранен свободный доступ.

Преимущества и недостатки клеммных механизмов фирмы Ваго

В клеммных зажимах Ваго изоляционным материалом является полиамид, обладающий способностью нейтрализовать коррозийные процессы, самопроизвольно гасить пламя, выдерживать температуру от +220˚С до –35˚С.

Соединение, полученное при помощи клеммы Wago, обладает массой достоинств:

  • отдельный клеммный зажим, фиксирующий каждый провод;
  • недоступность элементов, находящихся под напряжением, случайные касания к ним исключены;
  • качество соединения проводов не зависит от силы прижатия и квалификации мастера;
  • зажимное усилие клеммы соответствует сечению кабеля, что исключает повреждение и деформацию жил;
  • надежность полученного соединения;
  • повышенная устойчивость против вибраций и механических повреждений;
  • исключение окислительных процессов в местах соединения благодаря газонепроницаемости;
  • малые габариты;
  • полученные соединения не требуют дальнейшего технического обслуживания.

В домах, где электропроводка состоит из алюминиевого кабеля, часто приходится подсоединять приборы с медными токонесущими проводами. При обыкновенных скрутках в местах контакта различных металлов происходит появление характерной оксидной пленки на алюминиевых жилах. Оксидная пленка способствует разрушению алюминиевого провода и возникновению короткого замыкания.

Устройства Ваго применяются для смешанной сборки, невзирая на электрохимическую несовместимость алюминия и меди. Использование фирменных клеммников гарантирует высокое качество, безопасность и долгий срок службы комбинированного контактного узла.

Клемма Wago обладает одним недостатком – это высокая стоимость.

Монтажные операции при установке фирменных зажимов

Наиболее частое применение клеммные узлы фирмы Ваго нашли при монтировании разводок в распределительных коробках и щитках, подключениях осветительных приборов, бытового оборудования. С помощью фирменных устройств имеется возможность создавать соединения из одножильных и многожильных проводов.

Аварийные ситуации чаще всего возникают в местах соединения нескольких проводов. Это происходит вследствие возникновения переходного сопротивления в местах соединений. Большое значение имеет выбор подходящих разъемов для соединения проводов, чтобы соответствовать следующим требованиям:

  • отсутствие винтовых соединений;
  • большой срок эксплуатации;
  • устойчивость к вибрациям, воздействиям высоких температур;
  • повышенные изолирующие свойства;
  • материалы изготовления устойчивы против пожаров;
  • соответствие напряжению и силе тока в сети.

Как пользоваться клеммами Wago? Коммутация электрических проводников при помощи клеммы Ваго проводится в несколько операций:

  • очищение кабеля от изолирующего материала на расстояние 10–15 мм;
  • перевод зажима в виде флажка в верхнее положение;
  • вставка жилы в клемму, продвижение без усердия до упора;
  • защелкивание зажима при переводе его в нижнее положение, при этом провода закрепляются в клемме.

В клеммах Ваго имеется наполнение из специальной контактной пасты. Алюминиевые проводники автоматически лишаются окисной пленки и получают смазку, защищающую от окислительных процессов. Если перед установкой монтируемых алюминиевых кабелей замечены признаки окисления в виде темной окраски, следует произвести тщательную механическую очистку.

Удельное давление, которое создается в контактной точке, способствует прочной фиксации поверхностей уложенных проводников в слое из мягких металлов – свинца и олова, из которых состоит несущая рейка.  Это придает полученному соединенному узлу виброустойчивость, надежность и защищает место контакта от разрушительных воздействий коррозии.

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Как пользоваться клеммами «Ваго» | Раздел «Статьи»

Как пользоваться клеммами «Ваго»? ООО «Электрон-комплект» Статья

Под маркой Wago выпускается большой ассортимент универсальных клемм, предназначенных для соединения одножильных и многожильных проводников. Изделия подходят для использования не только с медными, но и с алюминиевыми жилами. Преимущества клемм «Ваго» включают высочайшую надежность, безопасность, большой срок службы и удобство использования. При изготовлении продукции применяются термостойкие полимеры, сочетающие небольшой вес и механическую прочность.

Область применения клемм включает самые разные работы по электромонтажу. Наиболее часто эти компоненты используются в распределительных щитах и коробках, а также при подключении осветительных приборов. Клеммы доступны в двух основных модификациях – для одножильных и для многожильных проводников. Отличие последней заключается в возможности изъятия провода нажатием специального рычажка, отводящего зажим.

Для подключения клемм «Ваго» серий 221 и 222 следует очистить конец проводника от изоляции приблизительно на 1 сантиметр, приподнять рычажок, вставить провод и вернуть зажим в нижнее положение. Для извлечения провода достаточно поднять рычажок.

Характерным примером клемм Wago для одножильных проводников являются серии 2273 и 773, предназначенные только для одножильных и опрессованных многожильных проводников. Подготовка и подключение провода осуществляется аналогично клеммам для многожильных проводников. Необходимо учитывать, что, несмотря на потенциальную возможность извлечения жилы из данной клеммы, делать это не рекомендуется из-за высокой вероятности деформации зажима, выполненного в виде металлической пластины с язычком.

Корректное использование изделий обеспечивает быстрый и надежный монтаж без использования специального инструмента. Клеммы позволяют соединять провода, имеющие токоведущие жилы различного сечения и материала. Благодаря компактным габаритам устройства могут размещаться в труднодоступных местах. Изделия не требуют применения дополнительной изоляции, необходимой при использовании обыкновенной скрутки или опрессовки.

Дополнительная информация по теме:

Приобрести клеммы Wago можно в каталоге компании «Электрон-комплект».

Зажим клемма Wago на 3 провода 0.08-2.5 мм кв без пасты 222-413 6шт

Описание

Предназначена для обеспечения соединения электрических многожильных проводов из меди или одножильных алюминиевых проводов, эксплуатируемых к электроцепи переменного тока. Изделие представляет собой набор металлических контактов в диэлектрическом корпусе с узлами для крепления. Допустимый диаметр для тонкопроволочных проводников – 0,08-4 мм.кв, для одно- и многожильных – до 2,5 мм.кв. Используют клеммник и при монтаже бытовых электропроводок, и при промышленном монтаже, где требования к надежности и выброусточивости значительно выше. Производитель клеммника – немецкая компания ”Wago”, являющаяся мировым лидером по выпуску клеммников с пружинной технологией соединения. Cмешанный электромонтаж и надежное подключение проводников. Каждому проводнику выделяется отдельное клеммное место. Качество подключения не зависит от аккуратных действий монтажника. Полная безопасность соединения.

Характеристики

  • Размеры
  • Длина:

    110 мм

  • Высота:

    29 мм

  • Ширина:

    105 мм

  • Вес, Объем
  • Вес:

    0.

    035 кг

  • Другие параметры
  • Производитель:

  • Страна происхож.:

    Германия

  • Торговая марка:

Характеристики

Торговый дом “ВИМОС” осуществляет доставку строительных, отделочных материалов и хозяйственных товаров. Наш автопарк — это более 100 единиц транспортных стредств. На каждой базе разработана грамотная система логистики, которая позволяет доставить Ваш товар в оговоренные сроки. Наши специалисты смогут быстро и точно рассчитать стоимость доставки с учетом веса и габаритов груза, а также километража до места доставки.

Заказ доставки осуществляется через наш колл-центр по телефону: +7 (812) 666-66-55 или при заказе товара с доставкой через интернет-магазин. Расчет стоимости доставки производится согласно тарифной сетке, представленной ниже. Точная стоимость доставки определяется после согласования заказа с вашим менеджером.

Уважаемые покупатели! Правила возврата и обмена товаров, купленных через наш интернет-магазин регулируются Пользовательским соглашением и законодательством РФ.

ВНИМАНИЕ! Обмен и возврат товара надлежащего качества возможен только в случае, если указанный товар не был в употреблении, сохранены его товарный вид, потребительские свойства, пломбы, фабричные ярлыки, упаковка.

Доп. информация

Цена, описание, изображение (включая цвет) и инструкции к товару Зажим клемма Wago на 3 провода 0. 08-2.5 мм кв без пасты 222-413 6шт на сайте носят информационный характер и не являются публичной офертой, определенной п.2 ст. 437 Гражданского кодекса Российской федерации. Они могут быть изменены производителем без предварительного уведомления и могут отличаться от описаний на сайте производителя и реальных характеристик товара. Для получения подробной информации о характеристиках данного товара обращайтесь к сотрудникам нашего отдела продаж или в Российское представительство данного товара, а также, пожалуйста, внимательно проверяйте товар при покупке.

Купить Зажим клемма Wago на 3 провода 0.08-2.5 мм кв без пасты 222-413 6шт в магазине Санкт-Петербург вы можете в интернет-магазине “ВИМОС”.

Статьи по теме

Клеммы ваги для соединения проводов или скрутка — что лучше

Без проводки не может обойтись ни одно жилое или производственное помещение. Разумеется, что для качественной прокладки проводов или кабелей нужно не только следовать грамотным чертежам и основам электромонтажа, но и следить за электрическим соединением проводов, которое невозможно без использования качественных соединителей. Сегодня особенно выделяются клеммники (ваги) и наконечники. Необходимо подробно разобраться, что такое ваги для соединения проводов, какими они бывают и в чем их преимущества.

Что такое клеммники Ваго

Клеммники — это специальные винтовые зажимы, которые используются для надежного электрического соединения проводников (провода, кабеля, шнура). Их применение в несколько раз безопаснее, чем классическая скрутка или спайка. В этом плане конкурировать с ними способны только наконечники и луженые гильзы. Клеммники позволяют соединять несколько проводов надежным контактом и при этом не повреждать их открытые жилки.

Клеммная колодка для проводов и кабелей

Способов крепления проводов несколько: классическое, когда они помещаются под головкой фиксирующего болта, и любительское, когда крепление осуществляется с помощью пластинки или других соединителей.

Хоть иногда и прибегают к использованию наконечников в сложных ситуациях, пользоваться клеммами удобнее. Они обеспечивают надежный и герметичный контакт и не способы при правильном использовании повредить жилу.

Вага одноразовая для мягкого провода на 3 контакта

К сведению! Если же говорить про «ваги», то не все могут сразу понять этот термин, но на самом деле все просто. Это бред WAGO, название которого стало именем нарицательным (по аналогии с ксероксом). Он занимается производством и продажей клеммников и является лидером мира в этой отрасли.

Характеристики клеммников Ваго

Клеммники бренда WAGO изготавливают из качественных материалов с учетом всех международных стандартов качества и безопасности. Обычно в качестве материла используют электролитическую медь, которую подвергают особому лужению. Также возможны варианты из хромоникелевой пружинной стали. В качестве элементов, выступающих диэлектриками, применяют составы из полиамида и поликарбоната, на которых и установлены все токопроводящие элементы конструкции.

Клемма WAGO 222-413

Применяются клеммники WAGO не только в промышленных производствах, на заводах или в технических помещениях, но в быту (частном доме или квартире). Они помогают провести свет к люстре или выполнить разветвление электрической проводки. За счет того, что производителем изготавливается достаточно широкий диапазон различных соединителей, их основные характеристики также сильно варьируются:

  • рабочее напряжение находится в пределах от 100 до 1000 В;
  • принимаемая сила тока колеблется от 6 до 323 А;
  • возможное сечение кабелей — 0,08-95 мм².
Клеммник Wago 2×0,08-2,5/4

Преимущества и недостатки вагов для соединения проводов

Клеммники от Ваго — это качественные соединители для электрических проводников. Они имеют свои достоинства и минусы, которые будут рассмотрены ниже. Сперва следует узнать основные преимущества:

  • для каждой жилки и каждого провода в кабеле в вагах есть свои зажимы;
  • ваги легко и быстро устанавливаются на любые виды проводников, если соответствуют их параметрам;
  • соединение не требует никакой дополнительной изоляции;
  • клеммники обладают компактными размерами;
  • выполнить соединение можно не только одинаковых проводов, но и кабелей с разным сечением и изготовленных из разных материалов;
  • ваги — одни из самых безопасных в использовании соединителей;
  • клеммники WAGO надежны и отличаются хорошими противоударными свойствами;
  • эксплуатация не требует никакого технического обслуживания соединения;
  • при необходимости контакт можно переделать, а клеммники легко заменить.

Обратите внимание! Если говорить о недостатках, то часто ими становятся цена и необходимость сохранения доступа к соединению. Второй пункт касается также и остальных контактов, выполненных путем разъемного соединения.

Варианты видов клеммников Ваго

Зажимы WAGO подразделяют на три самых популярных вида, основным различием между которыми является тип пружины, используемой в механизме:

  • плоская пружина;
  • Cage Clamp;
  • Fit-Clamp.

Соединители с плоской пружиной

Наиболее удобный вариант для быстрого монтажа. Повторно такие зажимы не используются. Ими рекомендуется скреплять одиночные проводники с сечением от 0,5 до 4 мм².

Плоскопружинный клеммник

Важно! Если нужно соединить гибкие многожильные кабеля, то перед установкой их спрессовывают.

Cage Clamp

Используются профессионалами для подключения ламп и прочих осветительных приборов. Также возможно применение для индуктивных датчиков передвижения, моторов, насосов, теплого пола, установок отопления и распределительных коробок. Они позволяют создавать контакт гибких и многожильных проводников без их предварительного прессования.

Cage Clamp

Fit-Clamp

Клеммники, обладающие врезными контактами. Это означает, что не придется заниматься предварительной зачисткой проводов перед их вставкой. Благодаря этому процесс соединения становится еще более простым и безопасным.

Fit-Clamp

Что лучше для соединения проводов — Wago или скрутка

Если обратиться к ПУЭ, то становится понятно, что о скрутке проводов там нет ни слова. Соединение происходит через зажимы, наконечники, клеммники, пайку и сварку. Скрутка хоть и является самым быстрым способом создания контакта, но в то же время быстро приходит в негодность и не соответствует никаким нормам и правилам безопасности при ремонте и обслуживании электроустановок.

Скрутка — это традиционный метод соединения проводов, который часто используют в цепях с маленьким напряжением. Она не требует обслуживания и каких-либо специальных инструментов, но в то же самое время отличается плохой влагоустойчивостью, требует дополнительной изоляции и не терпит соединения проводников из различных металлов.

Соединение скруткой не идет ни в какое сравнение с вагами

Обратите внимание! Клеммники Ваго в этом случае лишены всех подобных недостатков, так как обеспечивают надежный и безопасный контакт, который не нуждается в изолировании. Хоть они и не лишены минусов, такой подход будет выглядеть куда профессиональнее и умнее.

Как правильно использовать клеммники Ваго

Главное правило работы с клеммниками от WAGO подразумевает использование одной клеммы для одного контакта. В первую очередь провода подвергаются чистке от изоляции на 1-1,2 см. После этого их вставляют в соединитель до упора. Если на соединителе имеется зажим с рычагом, то до вставки его предварительно открывают. Когда же провод будет вставлен, рычаг опускают вниз с усилием и прижимают жилку клеммника.

Важно следить за тем, чтобы оголенные участки провода не выходили за пределы приспособления. В противном случае контакт будет нарушен, как и безопасность соединения.

Важно! Если что-то пошло не так, не следует использовать зажим второй раз, даже если он с виду выглядит нормальным и работоспособным. То же самое касается и их замены, которая производится время от времени.

Клещи для некоторых клеммников

Таким образом, винтовые клеммники для соединения проводов от WAGO — одно из лучших решений на рынке зажимов. Они в разы безопаснее скручивания, редко требуют каких-либо дополнительных инструментов для работы, кроме отдельных видов, когда могут понадобиться клеммные клещи.

Схематическое изображение ваго-вагусных рефлексов. Афферентные волокна блуждающего нерва …

Ядро солитарного тракта (NST) обрабатывает значительную висцеральную афферентную информацию и посылает расходящиеся проекции на широкий спектр мишеней ЦНС. NST важен для поддержания поведенческого и вегетативного гомеостаза и является источником, а также реципиентом значительных норадренергических (NE) проекций. Значение проекций NE от NST к другим регионам ЦНС давно оценено, но природа действия NE на сами нейроны NST, особенно на подтип рецептора альфа-1, является спорной.Мы использовали комбинацию методологий, чтобы систематически установить эффекты и клеточную основу действия агониста альфа-1, фенилэфрина (PHE), для контроля нейронов NST, ответственных за регуляцию ваго-вагусного рефлекса желудка. Иммуноцитохимические и ретроградные исследования подтвердили, что области postrema, A2, A5, области вентролатерального мозгового вещества и голубого пятна являются источниками катехоламинергических входов в NST. Электрофизиологические записи in vivo показали, что PHE активирует физиологически идентифицированные желудочные сенсорные NST-нейроны второго порядка.Микроинъекция ПГЭ in vivo на нейроны NST вызвала значительное снижение тонуса желудка. Наконец, исследования с использованием изображений кальция in vitro показали, что PHE вызывает резкие колебания кальция в цитозоле в нейронах NST. Эти колебания, вероятно, являются результатом взаимодействия между индуцированным агонистом и опосредованным инозитол-1,4,5-трифосфатом (IP (3)) высвобождением внутриклеточного кальция и контролем Са (2 +) -АТФазы внутриклеточных насосов для хранения кальция. Колебания сохранялись даже при перфузии раствора Кребса с нулевым содержанием кальция и EGTA, что позволяет предположить, что колебания кальция опосредуются в основном механизмами высвобождения-обратного захвата внутриклеточного кальция.Циклическая активация NST может увеличивать реакцию этих нейронов на входящий афферентный ввод (т.е. повышать «усиление»). Увеличение афферентного входа может вызвать усиление ответной части рефлекса и помочь объяснить мощные эффекты, которые агонисты альфа-1 оказывают на подавление перистальтики желудка и вызывают анорексию.

Повышенная активация канала TRESK K + способствует нарушению ваго-вагального рефлекса у диабетических крыс

Abstract

ИСТОРИЯ И ЦЕЛИ

Пациенты с диабетом имеют дефекты афферентного пути блуждающего нерва, которые приводят к нарушению функции желудочно-кишечного тракта.Мы исследовали, способствует ли избирательная повышенная активация 2-порового калиевого канала TRESK нарушению функции узловых ганглиев (NG), нарушая функцию желудочно-кишечного тракта у крыс с диабетом.

МЕТОДЫ

Мы провели цельноклеточные токовые зажимы и единичные записи нейронов NG от склонных к диабету крыс BioBreeding / Worcester и крыс с индуцированным стрептозотоцином диабетом (STZ-D) и сравнили с контрольными крысами. NG-нейроны крыс или культивируемых NG-нейронов подвергали действию фармакологических антагонистов и / или трансфицировали небольшой шпилькой или небольшими интерферирующими РНК, которые снижали экспрессию TRESK.Затем мы сделали электрофизиологические записи и изучили функции желудочно-кишечного тракта.

РЕЗУЛЬТАТЫ

Мы наблюдали снижение входного сопротивления, гиперполяризованного мембранного потенциала и повышение порогового значения тока, чтобы вызвать потенцирование действия в нейронах NG крыс STZ-D по сравнению с контролем. Возбудимость нейронов NG была аналогичным образом изменена у склонных к диабету крыс. In vivo разряды единичных нейронов NG в ответ на 30 и 60 пмоль октапептида холецистокинина были значительно ниже у крыс STZ-D по сравнению с контрольной группой. Снижение экспрессии канала TRESK K + восстановило возбудимость NG in vitro и in vivo, а также стимулированную CCK8 секрецию ферментов поджелудочной железы и индуцированную секретином моторику желудочно-кишечного тракта, которая опосредуется ваговагальными рефлексами. Эти аномалии являются результатом увеличения внутриклеточного Ca2 + в NG, активирующего кальциневрин, который, в свою очередь, связывается с NFAT-подобным сайтом стыковки на белке TRESK, что приводит к гиперполяризации нейрональной мембраны.

Выводы

На двухскоростных моделях диабета мы обнаружили, что активация канала TRESK K + снижает возбудимость NG и нарушает функции желудочно-кишечного тракта.

Ключевые слова: афферентный путь блуждающего нерва, аномальные функции желудочно-кишечного тракта при диабете, гипергликемия

Введение

Желудочно-кишечные функции часто нарушаются у пациентов с плохо контролируемым диабетом. 1 К ним относятся нарушение моторики пищевода, 2–5 нарушение аккомодации желудка, 6–7 аномальное опорожнение желудка, 2, 8 снижение функции поджелудочной железы 9,10 и неправильное пищевое поведение. 11, 12 Многие из этих функций опосредуются ваго-вагальными путями. 2, 8, 13 Нарушения функции блуждающего нерва часто встречаются у пациентов с длительным диабетом, хотя анатомические нарушения редко выявляются при гистологическом исследовании блуждающего нерва. 8, 14 Это предполагает, что дисфункция блуждающего нерва может быть вторичной по отношению к измененным электрофизиологическим свойствам узловых ганглиев (НГ), вызванным хронической гипергликемией. Двухпоровые калиевые каналы (2PK + ) играют важную роль в установлении мембранного потенциала покоя и возбудимости нейронов. 15–17 Регулирование каналов 2PK + нейротрансмиттерами и вторичными мессенджерами важно для функционирования нейронов в центральной нервной системе. 18 Семейство каналов 2PK + млекопитающих, которое состоит из 15 субъединиц, разделенных на 6 подсемейств: TWIK, TASK, TREK, TALK, THIK и TRESK, 17,18 проявляет различные электрофизиологические и фармакологические свойства и может опосредовать разные физиологические функции.

В предварительных исследованиях мы показали, что канал TRESK K + особенно распространен в НГ крыс, и его активация повышена у крыс с диабетом. 19 Мы предполагаем, что усиленная активация канала TRESK K + в капсаицин-чувствительном NG диабетических крыс приводит к гиперполяризации мембран, что приводит к снижению возбудимости и аномальным желудочно-кишечным функциям, опосредованным ваго-вагальным рефлексом, таким как секреция поджелудочной железы. и перистальтика желудка. Выключение канала TRESK K + у диабетической крысы должно восстановить возбудимость НГ и улучшить желудочно-кишечные функции, опосредованные ваго-вагусным рефлексом.Чтобы проверить эту гипотезу, мы провели эксперименты in vitro и in vivo, чтобы показать, что (i) гипергликемия у крыс BioBreeding / Worcester (BB / W) и индуцированного стрептозотоцином диабета (STZ-D) изменяет электрофизиологические свойства нейронов NG; (ii) гиперполяризация нейронов NG опосредуется повышением внутриклеточной концентрации Ca 2+ ([Ca 2+ ] i ), которая действует через кальциневрин для активации канала TRESK K + ; и (iii) подавление канала TRESK K + в NG восстанавливает желудочно-кишечные функции, опосредованные ваго-вагусным рефлексом при диабете.

Материалы и методы

Одобрение исследования

Все экспериментальные процедуры были выполнены в соответствии с руководящими принципами NIH и одобрены Университетским комитетом по использованию и уходу за животными Мичиганского университета.

Поколение диабетических крыс

Склонных к диабету и устойчивых к диабету самцов крыс BB / W в возрасте 21–23 недель (модели биомедицинских исследований) со средней концентрацией глюкозы в крови 437,6 ± 56,2 мг / дл (n = 20) и Использовали 89,7 ± 1,6 мг / дл (n = 15) соответственно.Крыс STZ-D получали, как описано ранее. (дополнительные методы)

Ретроградное отслеживание изоляции нейронов NG и NG, культивирование и электрофизиологические записи проводили, как описано ранее. (дополнительные методы)

Перенос миРНК TRESK в NG с использованием электропорации in vivo выполняли, как описано ранее. (дополнительные методы)

Регистрация in vivo нейрональной активности одиночных узлов выполнялась, как описано ранее. (дополнительные методы)

Исследование секреции поджелудочной железы и измерение внутрижелудочного давления проводили, как описано ранее. (дополнительные методы)

Исследования диспергированных ацинусов поджелудочной железы проводили, как описано ранее. (дополнительные методы)

Визуализацию [Ca 2+ ] i проводили, как описано ранее. (дополнительные методы)

Строительство pLentiLox 3.7 – TRESK shRNA и исследования трансфекции

Последовательности TRESK shRNA были сконструированы с базовой последовательностью siRNA, фланкированной тупыми п.о. T / A на 5′-конце и липким концом XhoI на 3′-конце (смысловая цепь: 5′-Phos- TCCCTCACTTCTTCCTCTTCTTCTCGAGAAGAAGAGGAAGAAGTGAGGGTTTTTTC-3 ‘; антисмысловая цепь: 5′-Phos-TCGAGAAAAAACCCTCACTTCTTCCTCTTCTTCTCGAGAAGAAGAGGAAGAAGTGAG GGA DNA Technologies-3’) (Integrated). Как смысловые, так и антисмысловые цепи были получены синтезом олигонуклеотидов с 5′-фосфатом и очисткой PAGE.Для субклонирования кшРНК комплементарные цепи каждой кшРНК отжигали и вставляли в сайты рестрикции HpaI и XhoI провирусной плазмиды pLentiLox 3.7 (pLL3.7). Генерацию лентивируса и трансфекцию проводили, как описано ранее. (дополнительные методы)

Вестерн-блоттинг против TRESK и CCK (разведение 1: 500, Santa Cruz Biotechnology) проводили, как описано ранее. (дополнительные методы)

Иммуноцитохимия

Для иммуногистохимического окрашивания срезы узловатых ганглиев инкубировали с козьими поликлональными антителами TRESK (1: 100, Santa Cruz Biotechnology) и кроличьими поликлональными антителами ваниллоидного рецептора 1 (VR1) (1: 100, Santa Cruz Biotechnology) и проанализировали, как описано ранее. (дополнительные методы)

Статистика

Все значения выражены как среднее ± SEM. Односторонний дисперсионный анализ (ANOVA) с поправкой Бонферрони для множественных сравнений использовался для сравнения более чем 2 групп, а непарный t-критерий использовался для сравнения 2 групп. Для сравнения нескольких факторов использовался двухфакторный дисперсионный анализ. P <0,05 считалось значимым. Обработка данных и статистический анализ выполнялись с использованием Origin 9 (OriginLab) и Microsoft Office Excel.

Результаты

Гипергликемия у крыс, склонных к диабету STZ-D и BB / W, изменяет электрофизиологические свойства нейронов NG. зажимные записи для сравнения основных нейронных свойств изолированных капсаицин-чувствительных (81 из 103, 78%) нейронов NG от контрольных и 2-, 4- и 8-недельных крыс STZ-D. Входное сопротивление нейронов NG и мембранный потенциал покоя были значительно снижены и увеличены, соответственно, у 4- и 8-недельных крыс STZ-D (

P <.05) (). Мембранный потенциал покоя ( V m ) составлял -55 ± 1,8 мВ (n = 31) и -63 ± 3 мВ (n = 30; P <0,05) в контрольных и 8-недельных диабетических нейронах NG, соответственно. Нейроны 8-недельных крыс с диабетом также показали снижение мембранного сопротивления до 67% ± 18% от контроля (n = 30, P <0,05). Кроме того, записи токового зажима показали, что 8-недельный диабет значительно увеличил реобазу до 353% ± 81% от контроля P <0,05) (). Мы также сравнили влияние диабета на NG-нейроны желудка и двенадцатиперстной кишки.Сравнение мембранных электрофизиологических свойств выступающих верхних отделов кишечника, ретроградно меченных DiI и немеченых нейронов у контрольных крыс и крыс STZ-D не выявило органоспецифичности диабетических сенсорных аномалий (дополнительная таблица 1). Эти данные показывают, что нейроны NG крыс STZ-D проявляют гиперполяризацию, что приводит к снижению возбудимости нейронов NG. Мы также провели запись токового зажима целых клеток с использованием нейронов NG от крыс BB / W. Подобно нейронам NG крыс STZ-D, нейроны NG (n = 20) крыс BB / W, склонных к диабету, демонстрировали более низкое входное сопротивление нейронов, более отрицательное V m и более высокий порог потенциала действия ( P < . 05) () по сравнению с нейронами от крыс, устойчивых к диабету BB / W того же возраста (n = 15).

Нейроны узловых ганглиев (NG) крыс с STZ-индуцированным диабетом (STZ-D) демонстрируют пониженную возбудимость in vitro. ( A ) Репрезентативные записи цельноклеточных нейронов NG от контрольных и 8-недельных крыс STZ-D: мембранный потенциал покоя -55 и -62 мВ и реобаза 10 и 100 пА в контрольных и диабетических нейронах NG. , соответственно. ( B ) Сводные гистограммы иллюстрируют значительно сниженное входное сопротивление нейронов ( R в ), более отрицательный мембранный потенциал покоя ( V m ) и повышенную амплитуду реобазы (pA) в нейронах NG от 2 -, 4- и 8-недельные крысы STZ-D по сравнению с контрольной группой (n = 10, 10, 31 и 30 соответственно, P <.05, однофакторный дисперсионный анализ с тестом Бонферрони, STZ-D по сравнению с контролем, n = 6–8 крыс). ( C ) Сводные гистограммы сравнивают входное сопротивление нейронов, мембранный потенциал покоя и реобазу в нейронах NG от BB / W устойчивых к диабету и склонных к диабету крыс (n = 20 и 15, соответственно; P <0,05, BB / W склонность к диабету в сравнении с устойчивым к диабету, непарный t-тест).

Чтобы показать, что STZ-индуцированный диабет изменяет сенсорные входы блуждающего нерва in vivo, были зарегистрированы одиночные нейрональные разряды нейронов NG.Данные были собраны из 47 записей одиночных нейронов NG, иннервирующих верхнюю кишку у 25 контрольных групп, и из 32 записей у 15 8-недельных крыс STZ-D. Все единицы, активируемые электрической стимуляцией поддиафрагмального блуждающего нерва, были протестированы с помощью инъекции холецистокинина (CCK) -8 в верхнюю панкреатодуоденальную артерию для обеспечения иннервации верхних отделов желудочно-кишечного тракта. Все единицы либо молчали, либо демонстрировали очень низкую спонтанную активность (0–1,5 импульса за 20 с) перед инфузией CCK-8.В контроле 15 из 47 нейронов ответили на внутриартериальные инъекции CCK-8 (30 и 60 пмоль), что привело к увеличению нейрональных разрядов от базальных 0,9 ± 0,3 до 16 ± 2 и 33 ± 4 импульсов за 20 с. соответственно (n = 15) ().

STZ-индуцированный диабет снижает частоту возбуждения нейронов в ответ на CCK-8 in vivo. ( A ) Репрезентативные записи ответов нейронов NG на инфузии 30 и 60 пмоль CCK-8 в верхнюю панкреатодуоденальную артерию у ( a ) контрольных и ( b ) 8-недельных крыс STZ-D.Обратите внимание, что CCK-8 (30 и 60 пмоль) генерировал значительно меньше потенциалов действия у крыс STZ-D по сравнению с контролем. ( B ) Сводная гистограмма показывает, что CCK-8 дозозависимо активировал афферентные волокна блуждающего нерва как у контрольных, так и у 8-недельных крыс STZ-D (n = 25 и 32 соответственно). Данные были собраны из записей 15 и 10 нейронов NG от контрольных и 8-недельных крыс STZ-D, соответственно. Обратите внимание, что влияние CCK-8 на частоту возбуждения нейронов в ответ на стимуляцию CCK-8 было значительно меньше у диабетических крыс по сравнению с контрольной группой.Данные выражены как среднее значение ± стандартная ошибка среднего. * P <0,05, STZ-D по сравнению с контролем, двухфакторный дисперсионный анализ ( C ). Сводная гистограмма сравнивает уровни CCKAR у контрольных (n = 5) и STZ-D (n = 5) крыс (несущественно, непарный t-критерий). Репрезентативный вестерн-блот показывает экспрессию CCKAR в NG от контрольных крыс и крыс STZ-D в течение 8 недель. Чтобы контролировать целостность выборки, актин оценивали как контроль нагрузки.

У 8-недельных крыс STZ-D 10 из 32 нейронов ответили на стимуляцию CCK-8. Инфузия CCK-8 вызвала значительно меньший спайковый потенциал по сравнению с контролем ( P <.01). Скорострельность в ответ на CCK-8 (30 и 60 пмоль) увеличилась с 1,5 ± 0,5 до 2 ± 0,1 и 4,0 ± 0,3 импульса за 20 с (n = 10) соответственно (). Напротив, ответы нейронов NG на CCK-8 у крыс STZ-D, получавших инсулин, были аналогичны контрольным (дополнительный рисунок 1). Чтобы гарантировать, что нейронные разряды были зарегистрированы из нейронов, экспрессирующих CCKAR, зарегистрированные нейроны были помечены нейробиотином после электрофизиологических записей, и в анализ были включены только нейроны, которые показали иммунореактивность CCKAR.Вестерн-блоттинг не показал изменений в экспрессии рецептора CCK-A в NG у 8-недельных крыс STZ-D (n = 5) (), что указывает на то, что снижение ответа NG на стимуляцию CCK не вызвано снижением количества рецепторов CCK.

Доказательства того, что повышенное содержание [Ca

2+ ] i в NG у крыс с диабетом модулирует возбудимость нейронов посредством пути кальциневрин – TRESK

Наши иммуногистохимические данные показывают, что все (100%) ваниллоидные рецепторы 1 (VR1 / TRPV1) ) –Экспрессирующие нейроны NG были иммунореактивны к анти-TRESK ().Затем мы исследовали механизм, с помощью которого гипергликемия активирует канал 2PK + TRESK. Мы предполагаем, что при диабете повышенное содержание [Ca 2+ ] i в нейронах NG может стимулировать кальциневрин и активировать канал TRESK K + , что приводит к гиперполяризации NG. Чтобы проверить эту гипотезу, мы измерили базальный интранейрональный Ca 2+ нейронов NG от контрольных и 8-недельных крыс STZ-D. Среднее значение базального [Ca2 +] i в контрольных малых нейронах NG составило 70 ± 5.2 нМ (n = 26) и 139 ± 8,3 нМ (n = 29) в нейронах NG 8-недельных крыс STZ-D (n = 26 и 29 соответственно, P <0,05) (). Увеличение [Ca 2+ ] i наблюдалось в нормальных нейронах NG крысы, инкубированных в среде с высокой концентрацией глюкозы (15 нМ) в течение 72 часов по сравнению с контролем (91 ± 7,2 нМ, n = 27, P <0,05) (). Чтобы показать, что [Ca 2+ ] i может модулировать потенциал мембраны нейронов NG и входное сопротивление, мы использовали кофеин для высвобождения Ca 2+ из межклеточных хранилищ (10 мМ, n = 5), 20 или Ca 2+ ионофор иономицин (1 мкМ, n = 9), чтобы вызвать рецепторнезависимое увеличение [Ca 2+ ] i .Внеклеточное применение кофеина или иономицина гиперполяризовало мембранный потенциал на 8,2 ± 3 мВ и 14 ± 3,5 мВ, соответственно, и снизило входное сопротивление до 56% ± 13% ( P <0,05) и 42% ± 11% ( P <0,05), соответственно (). Анализ вольт-амперной зависимости показал, что ингибирующее действие иономицина обращалось близко к теоретическому потенциалу реверсии K + (-105 мВ), предполагая, что активация канала K + опосредовала эффект (). На реакцию на иономицин не влияли апамин (100 нМ), ибериотоксин (100 нМ) или 8-Br-цАМФ (50 мкМ), которые, соответственно, составляют I SK , I BK , и I sAHP текущие антагонисты 21, 22 (n = 4) (дополнительный рисунок 2 A ). Точно так же селективный ингибитор Ca 2+ / кальмодулин-зависимой киназы KN-93 (10 мкМ) не оказывал антагонистического воздействия на ингибирование, вызванное иономицином (n = 5) (дополнительная фигура 2 B ).

Каскады передачи сигналов, ответственные за опосредованную глюкозой гиперполяризацию нейронов NG. ( A ) Локализация иммунореактивности VR1 ( красный ; разведение 1: 100) и TRESK ( зеленый ; разведение 1: 100) в NG. Наложенные микрофотографии TRESK и VR1 показывают, что VR1-иммунореактивные нейроны NG также проявляют иммунореактивность TRESK (, желтый, ). ( B ) Сводные данные [Ca 2+ ] i , измеренные для контрольных нейронов NG, культивированных (48 ч) в среде DMEM / F12, содержащей 5 мМ и 15 мМ глюкозы, и нейронов NG, полученных из 8-недельных STZ. Крысы -D, культивированные в среде DMEM / F12 (n = 26, 27 и 29 соответственно).Данные выражены как среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с контрольными нейронами NG, инкубированными в 5 мМ глюкозе; ** P <0,05, по сравнению с контролем, двухфакторный дисперсионный анализ. ( C ) Непрерывная регистрация мембранного потенциала в ответ на внеклеточное применение 10 мМ кофеина ( слева, ). Входное сопротивление нейронов проверялось путем подачи отрицательных импульсов тока (500 мс, 100 пА). Вольтамперные отношения, зарегистрированные в нейронах NG до и после нанесения 1 мкМ иономицина ( справа, ).Непрерывная регистрация мембранного потенциала в ответ на ( D ) внутриклеточный диализ кальциневрина (CaN, 30 мкМ) и ( E ) внеклеточное применение циклоспорина A (CyA, 1 мкМ). ( F ) Сводные данные об изменениях входного сопротивления нейрональной мембраны, вызванных внутриклеточным диализом кальциневрина (CaN, 30 мкМ, n = 5), циклоспорина A (CyA, 1 мкМ, n = 5), аутоингибитора кальциневрина. субъединица (CaN-I, 50 мкМ, n = 5), кофеин (Caff, 10 мМ, n = 5), иономицин (Ion, 1 мкМ, n = 9), совместное применение циклоспорина A и иономицин ( n = 4) и совместное применение аутоингибиторной субъединицы кальциневрина и иономицина (n = 5).Данные выражены как среднее значение ± стандартная ошибка среднего. * P <0,05, вещество (а) по сравнению с контролем, однофакторный дисперсионный анализ с тестом Бонферрони.

Среди каналов 2PK + только TRESK регулируется кальциневрином. 23 Мы показали, что внутриклеточный диализ кальциневрина (30 мкМ) вызывает гиперполяризацию (-17 ± 3 мВ, n = 5, P <0,05), наряду с 32% ± 10% снижением входного сопротивления нейронов ( P <0,05) (). Напротив, внутриклеточный диализ аутоингибиторной субъединицы кальциневрина (50 мкМ, n = 6) или внеклеточная суперфузия антагониста кальциневрина циклоспорина A (1 мкМ, n = 5) деполяризовали мембранный потенциал на 7. 5 ± 2,5 мВ ( P <0,05) и 5,6 ± 2,3 мВ ( P <0,05) и увеличили входное сопротивление нейронов на 117% ± 5,6% ( P <0,05) и 114% ± 7% ( P <0,05) соответственно (). Гиперполяризующий эффект иономицина (1 мкМ) не наблюдался в нейронах, подвергнутых диализу с использованием аутоингибиторного фрагмента кальциневрина (30 мкМ, в среднем 105% ± 8% от контроля, n = 5, P <0,05) () или обработанных внеклеточным применением. циклоспорина А (1 мкМ, среднее 98% ± 8% от контроля, n = 4, P <.05) (), что указывает на опосредование пути Ca 2+ –кальциневрин. Эти результаты показывают, что повышение [Ca 2+ ] i активирует кальциневрин и вызывает гиперполяризацию нейронов NG, подтверждая нашу гипотезу о том, что повышение базального [Ca 2+ ] i является критическим для активации пути кальциневрина. , что приводит к открытию канала TRESK K + и гиперполяризации нейронов NG при диабете.

Изучение эффектов пептида VIVIT (ингибитор стыковочного сайта NFAT) на электрические свойства NG у 8-недельных крыс STZ-D предоставило дополнительные доказательства того, что взаимодействие кальциневрина с каналом TRESK K + имеет решающее значение для индукции NG. гиперполяризация.Пептид VIVIT, по-видимому, ингибирует взаимодействие кальциневрин-белок TRESK в NFAT-подобном стыковочном сайте. 23, 24 Суперфузия пептида VIVIT (0,3 мкМ, n = 6) деполяризовала нейроны NG 8-недельных крыс STZ-D () и восстановила их возбудимость. Деполяризация была связана с увеличением входного сопротивления нейрональной мембраны () и снижением порога генерации потенциала действия (). Чтобы предоставить in vivo доказательства того, что взаимодействие кальциневрина с каналом TRESK K + необходимо для индукции гиперполяризации NG, мы микроинъектировали пептид VIVIT (1 мкМ) в NG 8-недельных крыс STZ-D и показали, что предварительная обработка NG с пептидом VIVIT частично восстановил ответ на стимуляцию CCK-8 (30 пмоль) (n = 7, P <. 05) (). Эти данные показывают, что [Ca 2+ ] i посредством активации канала TRESK K + модулирует мембранный потенциал покоя и возбудимость нейронов NG.

Пептид VIVIT нормализует возбудимость нейронов NG крыс STZ-D. ( A ) Непрерывная регистрация мембранного потенциала в ответ на VIVIT, пептид, ингибирующий проницаемый через мембрану сайт присоединения NFAT (столбик, 0,3 мкМ), показывает, что пептид деполяризовал нейроны NG, чтобы вызвать потенциалы действия в обоих контрольных ( верхний след ) и крысы СТЗ-Д ( нижний след ).( B ) Наложенные кривые напряжения, полученные в ответ на введение импульса постоянного тока (500 мс, 100 пА) до ( a , черная кривая) и после ( b , красная кривая) применения VIVIT, показывают, что влияние пептида было связано с увеличением входного сопротивления мембраны ( R, , , ). ( C и D ) Эффекты пептида на мембранный потенциал и входное сопротивление мембраны были более выражены в нейронах крыс STZ-D. Сводные графики показывают, что пептид VIVIT увеличил количество R в и уменьшил реобазу в нейронах NG от STZ-D (n = 7, P > 0,05) и контрольных крыс (n = 9, * P <0,05 ). ( E ) Репрезентативные записи in vivo ответов нейронов NG на инфузии CCK-8 (30 пмоль, внутриартериальный) до и после внутриузловой инъекции пептида VIVIT (1 мкМ) в контроле и 8-недельном STZ-D крысы. ( F ) Сводная гистограмма показывает разряды нейронов NG в ответ на стимуляцию CCK-8 (30 пмоль) у контрольных и 8-недельных крыс STZ-D.Микроинъекция пептида VIVIT (1 мкМ) в NG увеличивала скорость разряда нейронов NG в ответ на CCK-8. Данные были получены от 8 и 9 нейронов NG от контрольных крыс и крыс STZ-D соответственно. * P <0,05, VIVIT + CCK-8 по сравнению с CCK-8 в контроле. # P <0,05, VIVIT + CCK-8 по сравнению с CCK-8 у крыс STZ-D, двухфакторный дисперсионный анализ.

Отключение каналов TRESK K

+ восстанавливает возбудимость нейронов NG диабетических крыс

Ретровирусные векторы представляют собой эффективные инструменты доставки генов, которые могут стабильно экспрессировать shРНК в первичных клетках. Мы разработали лентивирусный вектор, который экспрессирует shРНК канала TRESK (shTRESK). Этот вектор был сконструирован для совместной экспрессии усиленного зеленого флуоресцентного белка (GFP) в качестве репортера трансфектора, что позволяет идентифицировать инфицированные клетки во время электрофизиологических и иммуноцитохимических исследований. Иммуноцитохимический анализ показал, что через 72 часа после трансфекции 85–90% культивируемых нейронов были GFP-положительными и показали слабую иммунопреципитацию или отсутствие иммунопреципитации для антител к TRESK (дополнительный рисунок 3 A ). ОТ-ПЦР и вестерн-блот-анализ первичных культур нейронов NG, инфицированных лентивирусным вектором, показали снижение экспрессии гена на 89% ± 5% (n = 6) и снижение экспрессии белка на 80% ± 3% (n = 6) (дополнительная информация Рисунок 3 B и C ).Таким образом, лентивирусный вектор способен стабильно экспрессировать трансгены, которые подавляют мРНК TRESK в нейронах NG. Были проведены электрофизиологические записи in vitro нейронов NG от контрольных и 8-недельных крыс, склонных к диабету STZ-D и BB / W. Эти нейроны трансфицировали скремблированным shRNA или вектором shTRESK. Нейроны NG из контроля, трансфицированные shTRESK, показали значительно более высокое входное сопротивление по сравнению с нейронами, трансфицированными скремблированной shRNA () или нетрансфицированными нейронами. Более того, 10 из 11 нейронов, трансфицированных shTRESK, были спонтанно активными и имели более положительный мембранный потенциал ().Это является прямым доказательством того, что канал TRESK K + участвует в регуляции возбудимости нейронов NG.

Влияние трансфекции shTRESK на основные мембранные свойства нейронов NG крыс с диабетом. ( A ) Репрезентативные записи токовых клещей и сводные данные ( B и C ), полученные от контрольных и 8-недельных крыс STZ-D до и через 96 часов после трансфекции shРНК. ( D ) Репрезентативные записи текущих фиксаций нейронов NG, полученные от BB / W диабет-устойчивых и склонных к диабету крыс до и после трансфекции shTRESK ( E и F ). Сводные гистограммы показывают влияние трансфекции shTRESK на входную резистентность мембраны ( R в ) и мембранный потенциал покоя (V m ) в контроле, 8-недельном STZ-D и BB / W, устойчивом к диабету и склонные к диабету крысы. Обратите внимание, что трансфекция shTRESK значительно увеличила R в и снизила V m в нейронах NG, полученных от контрольных крыс, крыс с предрасположенностью к диабету STZ-D и BB / W. Данные выражены как среднее ± стандартная ошибка среднего.* P <0,05 диабетик по сравнению с контролем; ** P <0,05 TRESK shRNA в сравнении с диабетом (6–10 нейронов в каждой группе) в однофакторном дисперсионном анализе с тестом Бонферрони.

Чтобы показать, что гиперполяризация, индуцированная [Ca 2+ ] i , опосредуется каналом TRESK K + , мы выполнили записи с токовым зажимом нейронов NG, трансфицированных скремблированным shRNA или вектором shTRESK. В нейронах, трансфицированных скремблированной кшРНК, внеклеточное применение иономицина (1 мкМ) гиперполяризовало мембранный потенциал аналогично нетрансфицированным нейронам (n = 6).Напротив, иономицин (1 мкМ) не вызывал ингибирующего ответа в нейронах NG, трансфицированных shTRESK (n = 6) (дополнительная фигура 4). Трансфекция нейронов NG от 8-недельных крыс с предрасположенностью к диабету STZ-D и BB / W вектором shTRESK восстанавливала возбудимость нейронов (). Трансфицированные нейроны от 8-недельных крыс STZ-D показали значительно более высокий R в и более низкий V m по сравнению с нейронами NG от диабетических крыс, получавших случайную shРНК (n = 6, P <.05) (). Фактически, зарегистрированные R в и V m были аналогичны записям в нейронах от контрольных крыс (). Подобные результаты наблюдались с нейронами NG от крыс BB / W, склонных к диабету (). Трансфекция нейронов NG от склонных к диабету крыс BB / W восстанавливала возбудимость нейронов (). Эти наблюдения подтверждают нашу гипотезу о том, что активация канала TRESK K + ответственна за гиперполяризацию нейронов NG, наблюдаемую у диабетических крыс.

Подавление канала TRESK K

+ in vivo восстанавливает реакцию NG на пептидную стимуляцию и нормализует желудочно-кишечные функции, опосредованные ваго-вагальным рефлексом у диабетических крыс

Чтобы предоставить прямые доказательства того, что канал TRESK K + отвечает за Нарушение функции NG у диабетических крыс, NG от 8-недельных крыс STZ-D подвергали электропорации с контролем (случайная последовательность) или миРНК TRESK и плазмидой pEGFP-N1. Запись одноклеточных нейронов in vivo выполнялась через 5 дней после электропорации миРНК.Как показано на фиг.4, у 8-недельных крыс STZ-D, у которых NG подвергали электропорации со случайной siRNA, инфузия CCK-8 (30 и 60 пмоль) не стимулировала возбуждение NG, как и у нелеченных диабетических крыс. Напротив, подавление TRESK в NG 8-недельных крыс STZ-D восстановило реакцию NG на стимуляцию CCK-8. Внутриартериальная инфузия CCK-8 (30 и 60 пмоль) увеличивала нейрональный разряд с базальных 0,6 ± 0,2 до 20 ± 3 и 37 ± 5 импульсов за 20 с соответственно (). Однако количество нейронов, отвечающих на CCK-8, не увеличивалось после электропорации с siRNA TRESK (15 из 45, 33%) по сравнению с нейронами, электропорированными с помощью контрольной si-РНК (8 из 25, 32%).Экспрессия гена TRESK снизилась до 32% от контроля через 5 дней после электропорации, что указывает на успешный нокдаун гена TRESK.

( A ) Репрезентативные единичные записи in vivo нейронов NG, полученные от контрольных и 8-недельных крыс STZ-D в ответ на инфузии 60 пмоль CCK-8 в верхнюю панкреатодуоденальную артерию. Правые NG подвергали электропорации с помощью миРНК со случайной последовательностью или миРНК канала TRESK. Обратите внимание, что подавление канала TRESK в NG восстанавливает ответы NG на стимуляцию CCK-8.( B ) Сводная гистограмма показывает разряды нейронов NG в ответ на внутриартериальные инъекции 60 пмоль CCK-8 крысам STZ-D, получавшим случайные siRNA- или TRESK siRNA. Данные были собраны для 8 и 15 нейронов NG от 8-недельных крыс STZ-D, обработанных случайными siRNA- и TRESK siRNA, соответственно. Обратите внимание, что влияние CCK-8 на частоту возбуждения нейронов было значительно больше у крыс, получавших TRESK siRNA, по сравнению с крысами, получавшими случайную siRNA. (n = 8 и 15 соответственно) * P <0,05, обработанные миРНК TRESK vs.нейроны NG, обработанные случайной миРНК, в ответ на стимуляцию CCK-8, непарный t-тест. ( C ) Репрезентативные единичные записи in vivo нейронов NG, полученные от контрольных крыс и крыс STZ-D в течение 8 недель в ответ на инфузию секретина (5 пмоль, внутриартериальный). Правые NG подвергали электропорации с миРНК случайной последовательности или миРНК TRESK за 5 дней до записи. Обратите внимание, что подавление канала TRESK в NG восстанавливает ответы NG на стимуляцию секретином. ( D ) Сводная гистограмма показывает разряд нейронов NG от контрольных крыс и крыс STZ-D в ответ на введение секретина.Данные собирали от 5 и 10 нейронов NG, обработанных случайной миРНК или миРНК TRESK, соответственно, полученных от крыс STZ-D. Обратите внимание, что частота возбуждения в ответ на секретин была значительно снижена у крыс STZ-D по сравнению с контрольной группой (* P <0,05, непарный t-критерий, n = 5). NG, обработанный миРНК TRESK (n = 10), полученный от 8-недельных крыс STZ-D, показал гораздо более высокий частотный отклик по сравнению с NG, обработанным случайной миРНК (** P <0,05, двусторонний дисперсионный анализ ANOVA).

В отдельных исследованиях мы исследовали влияние секретина на срабатывание NG.Секретин действует через афферентные пути блуждающего нерва, подавляя моторику желудка. 25, 26 Подобно CCK-8, внутриартериальная инфузия секретина (5 пмоль) 8-недельным крысам STZ-D (n = 5), чьи NG были трансфицированы случайной миРНК, не активировала возбуждение NG (2). С другой стороны, подавление TRESK в NG 8-недельных крыс STZ-D (n = 10) восстанавливает ответную реакцию NG на секретин (). Введение секретина (5 пмоль) увеличивало нейрональный разряд с базальных 0,7 ± 0,4 до 27 ± 3 импульсов за 20 с (n = 6, P <.05) у 8-недельных крыс STZ-D, в NG которых проводили электропорацию с помощью миРНК TRESK (). Эти данные подтверждают предположение, что нарушение работы канала TRESK K + в NG диабетических крыс отвечает за снижение ответа NG на стимуляцию CCK и секретином.

Чтобы изучить функциональное значение нарушения функции NG для пептидной стимуляции при диабете, мы провели исследования in vivo на 8-недельных крысах STZ-D для оценки ответа поджелудочной железы на стимуляцию CCK-8 (введение в верхнюю панкреатодуоденальную артерию, 60 пмоль · кг & -1 · ч -1 ), который действует через афферентные пути блуждающего нерва. 13 По сравнению с контролем, 8-недельные крысы STZ-D показали снижение выхода белка поджелудочной железы в ответ на стимуляцию CCK-8 на 45% ± 6% (n = 6, P <0,05) (). Электропорация левого и правого NG с помощью миРНК TRESK восстанавливала секрецию поджелудочной железы примерно до 85% от нормального уровня ().

Влияние подавления канала NG TRESK K + на секрецию панкреатического белка, стимулированную CCK-8, и стимулированную секретином моторику желудка у диабетических крыс

( A и B ) In vivo CCK-8-стимулированный белок поджелудочной железы секреция у контрольных и 8-недельных крыс STZ-D.Обратите внимание, что выход белка поджелудочной железы в ответ на стимуляцию CCK-8 (введение в верхнюю панкреатодуоденальную артерию, 60 пмоль · кг -1 · ч -1 ) был значительно меньше у диабетических крыс по сравнению с контрольной группой. Выключение канала TRESK K + в правом и левом NG через 5 дней после электропорации миРНК TRESK восстановило 85% ответа белка поджелудочной железы на стимуляцию CCK-8. * P <0,05 по сравнению с контролем; ** P <0,05 по сравнению с диабетическими крысами; n = 6 в каждой группе, однофакторный дисперсионный анализ с тестом Бонферрони.( C ) Репрезентативные записи подвижности внутрижелудочного давления показывают, что ответ на секретин (5 пмоль) был значительно меньше у 8-недельных крыс STZ-D по сравнению с контрольной группой. Выключение канала TRESK K + в правом и левом NG через 5 дней после электропорации миРНК TRESK значительно восстановило ответ внутрижелудочного давления на стимуляцию секретином. ( D ) Гистограмма суммирует результаты для ( C ) * P <0,05 по сравнению с контролями; ** P <.05 по сравнению с диабетическими крысами; n = 6 в каждой группе, однофакторный дисперсионный анализ с тестом Бонферрони.

Чтобы выяснить, является ли снижение секреции ферментов поджелудочной железы у крыс с СТЗ-индуцированным диабетом следствием внутренних аномалий ацинусов поджелудочной железы, вторичных по отношению к хронической инсулиновой недостаточности, мы провели рассредоточенные исследования ацинаров поджелудочной железы. Как показано на дополнительном рисунке 5. Сходные ответы амилазы на стимуляцию CCK-8 (0–300 пМ) наблюдались с диспергированными панкреатическими ацинусами крыс поджелудочной железы STZ в течение 8 недель и контрольных крыс.

Исследования подвижности in vivo включали измерение внутрижелудочного давления с помощью резинового баллона, вводимого в тело желудка через разрез двенадцатиперстной кишки. У контрольных крыс внутривенная инфузия секретина (5 пмоль), который действует через афферентные пути блуждающего нерва, 25, 26 вызывала временное расслабление желудка (2). Релаксантные эффекты секретина были заметно снижены у 8-недельных крыс STZ-D. Исследования моторики желудка, проведенные через 5 дней после электропорации левого и правого NG с помощью миРНК TRESK на 8-недельных крысах STZ-D, восстановили 80% релаксантных эффектов секретина, наблюдаемых в контроле ().

Обсуждение

Мы впервые показали, что усиленная активация канала TRESK K + происходит в НГ диабетических крыс, снижая возбудимость НГ и способствуя нарушению функций желудочно-кишечного тракта, опосредованному ваго-вагальным рефлексом. Наши результаты подтверждают этот вывод: (i) канал TRESK K + изобилует капсаицин-чувствительными нейронами NG, (ii) повышенная активация канала TRESK K + опосредуется кальциневрином Ca 2+ – Каскад каналов TRESK K + , приводящий к гиперполяризации и снижению возбудимости NG в отношении CCK и стимуляции секретином, (iii) подавление канала TRESK K + нормализует электрофизиологические свойства нейронов NG диабетических крыс и (iv) in vivo Подавление канала TRESK K + восстанавливает реакцию NG на пептидную стимуляцию и нормализует желудочно-кишечные функции, опосредованные ваго-вагусным рефлексом у диабетических крыс.

Изучение диабета на животных моделях и пациентов с диабетом выявило повышенное [Ca 2+ ] i в большинстве тканей. 27 Кругликов и его коллеги 28 показали, что при STZ-индуцированном диабете сигнал Ca 2+ удлиняется, а покоящиеся [Ca 2+ ] и прогрессивно повышаются в нейронах ганглиев задних корешков (DRG). при длительности диабета. Увеличение [Ca 2+ ] i , по-видимому, является результатом внутренних запасов и нарушенной повторной секвестрации Ca 2+ . 28 Нарушения гомеостаза [Ca 2+ ] и были предложены как распространенный путь в патогенезе неврологических осложнений диабета. 29 Было высказано предположение, что даже небольшое повышение концентрации глюкозы в крови может привести к значительному нарушению чувствительности. 30 В этом исследовании мы показали, что [Ca 2+ ] i в NG крыс, склонных к диабету STZ-D и BB / W, играет важную роль в изменении электрофизиологических свойств нейронов NG.

Наше открытие экспрессии различных каналов TRESK K + в NG крысы было подтверждено Zhao et al. 31 мРНК TRESK была первоначально обнаружена в спинном мозге и некоторых ненейрональных тканях, включая легкие, печень и почки. 32, 33 Количественные исследования показали, что канал TRESK K + наиболее распространен в DRG. 32 DRG нейроны мышей с функциональным нокаутом TRESK показали повышенную возбудимость, предполагая, что канал TRESK K + играет важную роль в регуляции мембранного потенциала покоя и возбудимости нейронов DRG. 34–36 Исследования цельноклеточных токовых клещей диссоциированных нейронов NG показали, что, хотя изменения электрофизиологических свойств (например, снижение R в и гиперполяризация V m ) наблюдались в 2-недельных STZ- у крыс с индуцированным диабетом () эти изменения не были статистически значимыми до 4 недель после индукции. Следовательно, хроническое повышение уровня глюкозы в крови необходимо, чтобы вызвать изменение электрофизиологических свойств NG при диабете. Затем мы изучили механизм, с помощью которого увеличенный [Ca 2+ ] i активирует канал TRESK K + .TRESK – единственный канал 2PK + , который, как сообщается, активирован [Ca 2+ ] i. 23 В нейронах NG крысы мы продемонстрировали, что гиперполяризующий эффект иономицина устраняется аутоингибиторным фрагментом кальциневрина или внеклеточным применением циклоспорина A, двух разных агентов, которые связываются с различными сайтами, включая аминоконце B-субъединицы. и каталитический домен кальциневрина. Эти данные показывают, что повышение [Ca 2+ ] и приводит к активации кальциневрина и гиперполяризации нейронов NG.Кроме того, применение циклоспорина A или пептида VIVIT, который ингибирует взаимодействие между кальциневрином и TRESK в NFAT-подобном стыковочном сайте, 23 полностью изменило аномальные электрофизиологические свойства нейронов NG у 8-недельных крыс STZ-D. Эти наблюдения подтверждают нашу гипотезу о том, что при диабете активация пути кальциневрина повышенным содержанием [Ca 2+ ] i в NG приводит к открытию каналов TRESK K + и гиперполяризации нейронов NG.

Возможно, что мембранный потенциал покоя регулируется другим чувствительным к Ca 2+ каналом (ами) K + в дополнение к TRESK. Ингибируя или подавляя канал TRESK K + , мы могли удалить компонент, регулирующий фоновые потенциалы, и таким образом обратить вспять гиперполяризацию, наблюдаемую в диабетических нейронах NG. Хотя это кажется маловероятным, мы не можем окончательно исключить эту возможность на основе нашего экспериментального плана.

Чтобы предоставить прямые доказательства того, что повышенная активность канала TRESK K + в NG ответственна за аномальный ответ NG на CCK и стимуляцию секретином, мы подавили экспрессию гена TRESK с помощью электропорации NG с миРНК TRESK.Электропорация использует короткие импульсы высокого напряжения для преодоления барьера клеточной мембраны. 37 Эта временная проницаемость используется для загрузки клеток лекарствами, индикаторами, РНК и ДНК и безопасна для животных и людей. 37 Заглушив канал TRESK K + в NG, а не где-либо еще, мы могли бы конкретно показать, что канал TRESK K + в NG отвечает за снижение возбудимости NG. Исследования RT – PCR и иммуногистохимии подтвердили успешное подавление экспрессии гена TRESK.Крысы с NG, обработанные миРНК TRESK для подавления канала TRESK K + , демонстрировали нормальные ответы на стимуляцию CCK-8 и секретином (). Точно так же подавление канала TRESK K + в NG диабетических крыс также восстанавливает панкреатический ответ и моторику желудка на стимуляцию CCK-8 и секретином, соответственно (- D ).

Наши наблюдения могут иметь патофизиологическое значение. Исследования показывают, что афферентные пути блуждающего нерва опосредуют физиологическое действие CCK, вызывая чувство сытости, уменьшая опорожнение желудка и регулируя секрецию ферментов поджелудочной железы у крыс и людей. 13, 38, 39, 40 Сообщается, что у людей экзокринная секреция поджелудочной железы снижена у диабетиков, у которых нет явного заболевания поджелудочной железы. 9, 10 Общий объем, выход амилазы и содержание бикарбоната снижаются у 50–75% диабетиков. В текущем исследовании аналогичное снижение секреции ферментов поджелудочной железы наблюдалось у 8-недельных крыс STZ-D, хотя исследования диссоциированных ацинусов поджелудочной железы in vitro не показали значительных различий в секреции амилазы в ответ на стимуляцию CCK между контрольной группой и 8-недельными STZ-крысами. D крысы (дополнительный рисунок 5).Наше наблюдение, что нейроны NG у 8-недельных крыс STZ-D гиперполяризованы с пониженной возбудимостью, дает возможное объяснение экзокринной недостаточности поджелудочной железы при диабете. Следует признать, что с прогрессированием диабета в более поздний момент времени может наблюдаться более серьезное снижение секреции поджелудочной железы, стимулированной CCK, и это может быть связано с внутренними аномалиями ацинусов поджелудочной железы, вторичными по отношению к хронической инсулиновой недостаточности. 41

Чтобы дополнительно продемонстрировать, что при диабете нарушение ваго-вагусного пути может привести к выраженным нарушениям желудочно-кишечной функции, мы провели исследования моторики желудка в ответ на секретин, который вызывает расслабление желудка через афферентные пути блуждающего нерва. 25, 26 Через никотиновые синапсы секретин стимулирует высвобождение вазоактивных кишечных пептидов из постганглионарных нейронов в кишечном сплетении желудка, что, в свою очередь, вызывает расслабление желудка. 26 Мы показали 80% снижение релаксации желудка в ответ на физиологическую дозу секретина у 8-недельных крыс STZ-D. Важно отметить, что эта аномалия была значительно устранена после отключения канала TRESK K + в NG.

В заключение, многослойный подход, включающий электрофизиологию с токовым зажимом, подавление генов в культивируемых нейронах NG крыс, а также электрические записи in vivo одиночных клеток и исследования секреции поджелудочной железы и моторики желудка на двух моделях диабета на животных, показал, что активация каскада каналов Ca 2+ –кальциневрин – TRESK K + в НГ происходит при диабете.Это отвечает за снижение возбудимости НГ и способствует нарушению функций желудочно-кишечного тракта, которое опосредуется ваго-вагусным рефлексом. Наши результаты представляют собой привлекательную объединяющую гипотезу для объяснения широко распространенных желудочно-кишечных расстройств у пациентов с диабетом. Понимание каскада передачи сигнала, опосредующего аномалии, может обеспечить важные терапевтические цели для лечения пациентов с диабетом с желудочно-кишечными осложнениями.

центральный контроль перистальтики желудка и модуляция эндогенными опиоидами

Описание

Диссертация (Ph.D.) – Джорджтаунский университет, 2009 г .; Включены библиографические ссылки .; Текст (Электронный тезис) в формате PDF. Медиальное подъядро солитарного тракта (mNTS) является центральным компонентом ваго-блуждающего контура, который получает сенсорную информацию от внутренних органов и проецируется на дорсальное моторное ядро ​​блуждающего нерва (DMV), источник моторной отдачи в желудок. Центральная гипотеза моей диссертации заключалась в том, что передача сигналов ГАМК в mNTS регулирует активность ваго-вагальных цепей и определяет тонус желудка в состоянии покоя.Используя препарат in vivo, я микроинъектировал лекарства в мНТС анестезированных крыс, контролируя внутрижелудочное давление (IGP). Микроинъекция антагонистов рецепторов GABAA снижала IGP и подавляла моторику и предотвращалась ваготомией, блокадой ионотропных рецепторов глутамата или блокадой периферических мускариновых холинергических рецепторов. Используя препарат мозговых срезов in vitro, я выполнил регистрацию напряжения и тока целых клеток и обнаружил, что мНТС-нейроны, проецирующие желудок, обладают как тоническими, так и фазическими токами ГАМК, которые регулируют возбудимость мНТС.Это привело к гипотезе о том, что активация мю-опиоидных рецепторов в mNTS влияет на моторику желудка за счет модуляции локальной активности ГАМК. Используя препарат in vivo, я обнаружил, что стимуляция мю-опиоидных рецепторов в mNTS снижает IGP и предотвращается ваготомией, блокадой мю-опиоидных рецепторов, рецепторов GABAA, ионотропных рецепторов глутамата или периферических мускариновых холинергических рецепторов. Последующая гипотеза заключалась в том, что высвобождение эндогенных опиоидов в mNTS является компонентом рецептивного рефлекса релаксации (RRR).Экспериментальная модель RRR включает растяжение небольшого баллона в пищеводе, что вызывает снижение тонуса глазного дна. Используя эту модель для RRR, я обнаружил, что снижение тонуса глазного дна предотвращалось предшествующей блокадой мю-опиоидных рецепторов в mNTS или системной блокадой мю-опиоидных рецепторов; Исследования из моей диссертации представляют доказательства того, что 1) существует высокий уровень внутренней передачи сигналов ГАМК в mNTS, которая регулирует моторику желудка; 2) в нейронах mNTS присутствует как тоническая, так и фазовая передача сигналов ГАМК; 3) стимуляция мю-опиоидных рецепторов в mNTS подавляет моторику желудка, подавляя текущую активность ГАМК; и 4) стимуляция ваго-вагусного рефлекса вызывает высвобождение эндогенных опиоидов в мНТС, которые ингибируют текущую активность ГАМК.

IL NERVO VAGO в английском переводе

IL NERVO VAGO в английском переводе нерв вагодель нерв блуждающий нерв Нерво ваго Проводите свои собственные слова и слова.Блуждающий нерв проводит сигналы изо рта и струфувудет рыси. L’arteria carotidea interna, la vena giugulare interna e il nervo vago .Внутренняя сонная артерия, внутренняя яремная вена и блуждающий нерв . Нерво ваго Порта пои, чтобы пройти через желудочно-кишечный тракт. Блуждающий нерв затем переносит аксоны к месту назначения в желудочно-кишечном тракте. Нервный вагон и Ил куоре === Иннервация автономной паразитарной системы нервной системы и медиатек нервной системы .Блуждающий нерв и сердце === Парасимпатическая иннервация сердца частично контролируется блуждающим нервом и разделяется на грудные ганглии.La gastroparesi può insorgere nel caso in cui il nervo vago è danneggiato, Гастропарез может возникать при повреждении блуждающего нерва , и мышц. Il nervo vago fornisce fiber parasimpatiche и все органические, fatta eccezione per Блуждающий нерв поставляет моторные парасимпатические волокна ко всем органам (кроме надпочечников), Il nervo vago finisce per danneggiarsi dopo anni di glicemia alta, Блуждающий нерв повреждается из-за многолетнего высокого уровня глюкозы в крови Tali ricettori trasmettono segnali al Cervello Attackverso il nervo vago , provocando la sensazione di sazietà.Эти рецепторы посылают сигналы в мозг через блуждающий нерв , вызывая ощущение полноты. I batteri интестинальные возможности comunicare con il cervello attroverso il nervo vago si parla diasse microbioma-Кишечник-сервелло 8.Бактерии в кишечнике могут общаться с мозгом через блуждающий нерв , называемый осью 8 микробиом-кишечник-мозг.cervello per poi raggiungere le cellule Кишечные аттракционы il nervo vago .Quanto sono sicuro che il nervo vago e i nervi toracici spinali abbiano un Насколько я уверен, что блуждающий нерв , и спинно-спинномозговые вспомогательные нервы передают Quando la pressione si abbassa, il nervo vago si calma, l’impulso torna ai livelli normali.При понижении давления блуждающий нерв успокаивается, пульс восстанавливается до нормального уровня. Alcune informazioni sul gusto vengono anche trasmesse dalla faringe attachverso il nervo vago .Abbiamo gia ‘confermato Che i vasi coronarici e il nervo vago non sono stati colpiti.была установка зажимов, чтобы коронарные сосуды и блуждающий нерв не были затронуты.Abbiamo gia ‘confermato Che i vasi coronarici e il nervo vago non sono stati colpiti.Размещение зажимов не повлияло на коронарные сосуды и блуждающий нерв . Per normalizzarlo, viene attivato un fattore di компенсация- il nervo vago , che, una volta attivato, Для его нормализации активируется компенсаторный фактор – блуждающий нерв , который при активации Аномалия блуждающего нерва – il nervo vago fornisce fiber nervose alla casella vocale (laringe), Аномалия блуждающего нерва – блуждающий нерв поставляет нервные волокна в голосовой ящик (гортань), Abbiamo gia ‘confermato Che i vasi coronarici e il nervo vago non sono stati colpiti.но мы уже подтвердили, что коронарные сосуды и блуждающий нерв не были затронуты.nervo faciale (VII), il nervo glossofaringeo (IX) e il nervo vago X.языкоглоточный нерв (CN IX) и блуждающий нерв CN X. блуждающих нервов , от которых отходят возвратные гортанные нервы, e alla parte posteriore della lingua, il nervo vago fornisce innervazione ai muscoli nella voce задняя часть языка, vagus обеспечивает иннервацию мышц голосового аппарата Il nervo glossofaringe (IX), il nervo vago (X) и другие аксессуары (XI) Языкоглоточный (IX), блуждающий нерв (), (X) и добавочный нерв (XI) le funzioni nella lingua e il gusto, il nervo vago che invia segnali al cuore, горло, движение языка и вкус), блуждающий нерв (который посылает сигналы сердцу, è che nei pesci il nervo vago ha rami che forniscono le ultime tre delle sei branchie состоит в том, что у рыб блуждающий нерв имеет ответвления, которые снабжают последние три из шести жабр, Richiede знает, что такое Danneggiando il nervo vago … con un solo colpo al tempio.Требуются необычные навыки Чтобы повредить блуждающий нерв … одним ударом в висок. Dovrebbe essere sezionato… per ridurre l’acido… E preventire il ripetersi di ulcera? Non è forse vero che in questa operazione i nervi vaghi ? Разве это не правда, сэр, что во время этой операции нужно перерезать блуждающих нервов , чтобы уменьшить поток кислоты. Показать больше примеров

Результатов: 71, Время: 0.0667

Уведомление
Этот веб-сайт или его сторонние инструменты используют файлы cookie, которые необходимы для его функционирования

и необходимы для достижения цели, указанные в политике использования файлов cookie.Если вы хотите узнать больше или отказаться ваше согласие на использование всех или некоторых файлов cookie, см. политику в отношении файлов cookie.
Закрывая этот баннер, прокручивая эту страницу, щелкая ссылку или продолжая просмотр иным образом, вы соглашаетесь на использование файлов cookie.

Более Ok

Отказ от продажи личной информации
Мы не будем продавать вашу личную информацию, чтобы сообщать вам о рекламе. Вы по-прежнему можете видеть рекламу на основе интересов, если ваш информация продается другими компаниями или была продана ранее.Отказаться Увольнять

Международный имени Франко Ваго – AZFreight

Что такое “А-Я-Следование”?

AZ Follow позволяет вам сохранять интересующие вас объявления и легко ссылаться на них в следующий раз.

Когда вы подписываетесь на объявление, оно сохраняется в разделе «Следующие» на странице «Моя учетная запись» .Вы также можете добавить личные заметки к вашим спискам, на которые вы подписаны, чтобы помочь вам вспомнить, что вас в них интересовало.

Вы можете легко подписаться на списки или отписаться от них, просто щелкнув переключатель подписки.

Эта функция требует, чтобы у вас была учетная запись на AZFreight. Пожалуйста, зарегистрируйтесь или войдите сейчас.

261682

0

Вы собираетесь получить все эти дополнительные преимущества: Бесплатный листинг
Премиум листинг
Название компании, адрес, тел., Факс, Skype, электронные сообщения и профиль
Отображенный логотип компании
Прямая ссылка на веб-сайт
Получите прямые запросы расценок
Посетители отправят вам запросы расценок прямо со страницы, указанной в списке Premium.
Гарантированные приглашения к участию в торгах
Ценовое предложение по ВСЕМ запросам цен на фрахт для вашей страны.
Прямой доступ к электронной почте запрашивающего расценки
Получите прямой адрес электронной почты всех запрашивающих расценки, ищущих экспедиторов в вашей стране.
Нет рекламы в вашем объявлении Страница
Ваше объявление принадлежит только вам.Удалите из него списки премиум-класса с таргетингом на страну и очистите его от всей другой рекламы.
Промоакция в рамках Недели грузовых авиаперевозок
Новые списки премиум-класса приветствуются и рекламируются в цифровых изданиях ACW Print и (читательская аудитория: 24 000)
(только для подписчиков на срок от 6 месяцев до 3 лет)
Продвижение во всех социальных сетях Azura International
Новые премиум листинги продвигаются на всех платформах социальных сетей (подписчиков: 18 500)
(только для подписчиков на срок от 6 месяцев до 3 лет)
Отправить больше писем
Лимит вашей электронной почты для AZListings составляет 5 в день.Переходите на Премиум, и вы можете отправить до 100!
5 100
Таргетинг на посетителей по странам
Вы говорите, из каких стран вы хотите вести бизнес (до 6), и вы будете получать исключительно целевой трафик на свою страницу с домашней страницы, страницы каталога и всех страниц с листингами. Это уникальное преимущество!
Выделено первым в результатах поиска по всем функциям / странам
Владейте результатами поиска! Ваше объявление отображается вверху.Он выделен и отображает вашу контактную информацию, в отличие от других списков. Это также относится к домашней странице, странице каталога и всем страницам со списками.
Выделенные результаты поиска по мере ввода
Еще больше переходов по ссылкам с домашней страницы, страницы каталога и всех страниц со списками из популярного поля быстрого заполнения поиска компании.
Немедленное обновление страниц профиля
Больше не нужно ждать, пока мы модерируем ваши изменения.
Ссылка и логотип на всех страницах.
Ваша ссылка и логотип отображаются на всех страницах с объявлениями. Дважды, если посетитель из целевой страны!
Отображать видео на странице профиля (не более 10).
Приведя их на свою страницу, порадуйте потенциальных и потенциальных клиентов богатым контентом о вашей компании.
Контекстная навигационная панель Premium.
Всплывающее всплывающее окно с названием вашей компании отображается на панели «Премиум» во всех объявлениях той же страны и учреждения, что и ваше. Во всплывающем окне отображается ваш логотип, описание и ссылка на вашу страницу.
Ваша компания размещена в верхней части страницы вашей страны.
Страницы стран входят в число самых посещаемых целевых страниц на сайте!
Отображение брошюр в формате PDF.
Еще больше способов снабдить ваших потенциальных клиентов самым сильным материалом.

Выберите подписку:

Вы обновляете Franco Vago International () – экспедитор
Срок Варианты оплаты Цена

Ежемесячно


35 фунтов стерлингов.00 / в месяц Купить ежемесячную премию

6 ежемесячно

£ 190,00 каждые 6 месяцев Купить премиум на полгода

Ежегодно

360 фунтов стерлингов.00 / год
САМОЕ ПОПУЛЯРНОЕ
Купить годовую премию

2 Ежегодно

640,00 £ каждые 2 года Купить 2-летнюю премию

3 Ежегодно

920 фунтов стерлингов.00 каждые 3 года Купить 3-летнюю премию

{“wpcf-email-sendex-score”: [“0.713”], “wpcf-country-latlng-code”: [“718”], “wpcf-country-alpha”: [“us”], “wpcf -country-name “: [” Соединенные Штаты “],” wpcf-office-location “: [” Springfield Gardens “],” wpcf-full-phone “: [” + 1 718 528-5200 “],” wpcf- полный-компания-факс “: [” + 1 718 525-0029 “],” wpcf-company-website “: [” www.francovago.com “],” wpcf-source “: [” cargoyellowpages.com “],” wpcf-general-email “: [” [email protected] “],” wpcf-office-address “: [” NY, 145-43 226th Street, NY 11413, США “],” wpcf-last_manual_update_by “: [” “],” wpcf-last_manual_update “: [” 2021-07-08 “],” wpcf-AZ_last_update “: [ «2011-10-13»], «wpcf-az_email_status»: [«хорошо»]}

Чтобы отредактировать объявление, войдите или зарегистрируйтесь.

Спрингфилд Гарденс

NY, 145-43 226th Street, NY 11413, США

+ 1718528-5200

+ 1718525-0029

Эти премиальные компании приглашают запросы из России

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *