Содержание

Реле КамАЗ

org/Product”>

Код товара: 091219

Реле блокировки стартера КАМАЗ

Артикул: 2602.3747 Производитель ЭлектроМехИзмерение ЗАО 2602.3747

Код товара: 223145

Реле втягивающее стартера ЗИЛ-5301,ГАЗ-3309 24V (ст.
AZJ3353,3381,3427) MAHLE

Артикул: MSX357KIT (16.670.263) Производитель MAHLE/KNECHT MSX 357KIT

Код товара: 223183

Реле втягивающее стартера КАМАЗ 24V (ст. AZJ3367,3436,11.131.522) MAHLE

Артикул: MSX1260 (16.670.421) Производитель MAHLE/KNECHT MSX 1260

org/Offer”>

Код товара: 017228

Реле втягивающее стартера КАМАЗ БАТЭ

Артикул: СТ142-3708800 Производитель БАТЭ г. Борисов СТ142-3708800

Код товара: 470693

Реле втягивающее стартера КАМАЗ стартер BOSCH

Артикул: 2339402362 Производитель BOSCH 2339402362

org/Offer”>

Код товара: 104573

Реле втягивающее стартера КАМАЗ ЭЛТРА

Артикул: 2501.3708.800-10 Производитель ЭЛТРА г.Ржев 2501.3708.800-10

Код товара: 075028

Реле зуммер КАМАЗ АВАР

Артикул: 733. 3747-10(РС531) 24V Производитель АВАР ОАО г.Псков 733.3747-10

Код товара: 581778

Реле контрольной лампы 5002.3787 КАМАЗ Евро-3 – КАМЭК (ПОД ЗАКАЗ)

Артикул: 5002.3787 Производитель КАМЭК 5002.3787

org/Offer”>

Код товара: 245820

Реле поворота ГАЗ-3309 24В 4-х контактное ЭНЕРГОМАШ

Артикул: 642.3747-03 Производитель Энергомаш ЗАО г.Калуга 642.3747-03

Код товара: 017237

Реле поворота МАЗ,КАМАЗ АВТОПРИБОР

Артикул: РС951А Производитель АВТОПРИБОР г.

Владимир РС951А-3726010

Код товара: 116777

Реле поворота МАЗ,КАМАЗ РЕЛКОМ

Артикул: РС951А Производитель РЕЛЕЙНАЯ КОМПАНИЯ + ООО РС951А

org/Offer”>

Код товара: 093067

Реле поворота МАЗ,КАМАЗ ЭМИ

Артикул: 57.3777(РС951А) Производитель ЭлектроМехИзмерение ЗАО 57.3777

Код товара: 102803

Реле поворота МАЗ,КАМАЗ ЭНЕРГОМАШ

Артикул: 718. 3777 (аналог РС951А) Производитель Энергомаш ЗАО г.Калуга 718.3777

Код товара: 112340

Реле поворота МАЗ,КАМАЗ-ЕВРО РЕЛКОМ

Артикул: РС951EU НЧ Производитель РЕЛЕЙНАЯ КОМПАНИЯ + ООО РС951EU

org/Offer”>

Код товара: 233931

Реле поворота МАЗ,КАМАЗ-ЕВРО ЭМИ

Артикул: 57.3777-01(РП3402.3777-22) Производитель ЭлектроМехИзмерение ЗАО 57.3777-01

Интернет: нет в наличии

Код товара: 236019

Реле поворота МАЗ,КАМАЗ-ЕВРО ЭНЕРГОМАШ

Артикул: 718.3777-01 Производитель Энергомаш ЗАО г.Калуга 718.3777-01

Код товара: 227032

Реле регулятор напряжения 28V индукционные ген. АВТОЭЛЕКТРОНИКА

Артикул: 7342. 3702 Производитель Автоэлектроника ОАО г. Калуга 7342.3702

Код товара: 357266

Реле регулятор напряжения КАМАЗ дв.CUMMINS DAF VOLVO BOSCH

Артикул: F00MA45248/F00M144118 Производитель BOSCH F00MA45248

org/Offer”>

Код товара: 099505

Реле регулятор напряжения КАМАЗ СБ АТЭ-1

Артикул: 1312.3771-010 Производитель АТЭ-1 1312.3771-010

Код товара: 017230

Реле регулятор напряжения КАМАЗ,МАЗ (Г273В,65/6522/6562. 3701) ЭНЕРГОМАШ

Артикул: Я120М1 Производитель Энергомаш ЗАО г.Калуга Я120М1

Предохранители и реле КамАЗ-5490, 65206, 65207.

ОбозначениеНоминалПотребительСостояние выключателя основного питания / замка зажигания
FU1.15AБлок управления ЭФУВкл / ON
FU1.25AБлок управления пневмоподвескойВкл / ON
FU1. 35AБлок управления электрооборудованием (CBCU)Вкл / ON
FU1.45AБлок управления EBSВкл / ON
FU1.55AБлок управления двигателем ADM3Вкл / ON
FU1.610AБлок управления системы нейтрализацииВкл / ON
FU1.710AБлок управления двигателем MR2Вкл / ON
FU1.8  Вкл / ON
FU1.910AБлок управления ретардеромВкл / ON
FU1.105AРазъем OBD диагностикиВкл / ON
FU1.115AТахограф \ комбинация приборовВкл / ON
FU1.125AРазъем для спец. надстроекВкл / ON
FU2.1  Вкл / ON
FU2.210AПанель управления со стороны водителяВкл / ON
FU2. 3  Вкл / ON
FU2.45AОбмотка возбуждения генератораВкл / ON
FU2.55AБлок управления центральным замкомВкл / ON
FU2.6  Вкл / ON
FU2.75AПривод управления люкаВкл / ACC
FU2.820AКондиционерВкл / ACC
FU2.915AПанель управления со стороны водителяВкл / ACC
FU2.1015AПанель управления дверь со стороны пассажираВкл / ACC
FU2.115AАудиосистемаВкл / ACC
FU2.1210AПрикуривательВкл / ACC
FU3.115AБлок управления EBSВкл / 0
FU3.215AEBS прицепаВкл / 0
FU3. 315AБлок управления пневмоподвескойВкл / 0
FU3.415AОсушительВкл / 0
FU3.5  Вкл / 0
FU3.610AБлок управления ретардеромВкл / 0
FU3.710AКомбинация приборовВкл / 0
FU3.820AБлок управления ЭФУВкл / 0
FU3.910AРазъем OBD диагностикиВкл / 0
FU3.1010AБлок управления электрооборудованием (CBCU) гр.3Вкл / 0
FU3.1120AБлок управления электрооборудованием (CBCU) гр.4Вкл / 0
FU3.1215AБлок управления EBSВкл / 0
FU4.120AЭлектронасос подъёма\отпускания кабиныВкл / 0
FU4.210AОсвещение салонаВкл / 0
FU4. 310AРазъем для спец. надстроекВкл / 0
FU4.45AПитание клавиш и датчиковВкл / 0
FU4.510AАудиосистемаВкл / 0
FU4.610AОбогрев стеклаВкл / 0
FU4.710AФара сцепкиВкл / 0
FU4.810AРозетка 24ВВкл / 0
FU4.910AЗвуковой сигналВкл / 0
FU4.105AРеле дистанционного выключения АКБВкл / 0
FU4.11  Вкл / 0
FU4.12  Вкл / 0
FU5.115AПодогрев топлива в топливозаборникеНе зависит / 0
FU5.215AПодогрев топлива в ФГОТНе зависит / 0
FU5. 3  Не зависит / 0
FU5.45AТахографНе зависит / 0
FU5.510AБлок управления двигателем ADM3Не зависит / 0
FU5.615AБлок управления системы нейтрализацииНе зависит / 0
FU5.720AБлок управления электрооборудованием (CBCU) гр.1Не зависит / 0
FU5.820AБлок управления электрооборудованием (CBCU) гр.2Не зависит / 0
FU5.920AБлок управления электрооборудованием (CBCU) гр.5Не зависит / 0
FU5.1020AБлок управления электрооборудованием (CBCU) гр.6Не зависит / 0
FU5.1125AПЖДНе зависит / 0
FU5.12  Не зависит / 0
FU6.115AБлок управления электрооборудованием (MUX4-P)Не зависит / 0
FU6. 215AБлок управления электрооборудованием (MUX4-P)Не зависит / 0
FU6.315AБлок управления электрооборудованием (MUX4-P)Не зависит / 0
FU6.415AБлок управления электрооборудованием (MUX4-P)Не зависит / 0
FU6.515AБлок управления электрооборудованием (MUX4-P)Не зависит / 0
FU6.615AБлок управления электрооборудованием (MUX4-P)Не зависит / 0
FU6.715AПодогрев сиденьяВкл / ON
FU6.8  Вкл / ON
FU6.915AБлок управления центральным замкомВкл / 0
FU6.10  Вкл / 0
FU6.11  Вкл / 0
FU6.12  Вкл / 0

принцип работы, неисправности и методика выбора |

Все современные автомобили оснащаются световыми устройствами, призванными указать остальным участникам движения, в какую сторону будет разворачиваться транспортное средство. Их еще называют световыми указателями поворота. Работают они, как все наверняка знают, в прерывистом режиме. Как раз за прерывание их работы отвечает специальное реле, в устройстве и неисправностях которого мы попытаемся разобраться.

Немного о функциях реле поворота

Реле поворота имеет несколько названий. Это и прерыватель тока, и реле-прерыватель указателей поворота, и просто реле поворота. Во всех случаях речь идет об электронном или же электромагнитно-тепловом приборе, отвечающим за замыкание и размыкание цепей световых указателей. Во время их работы световой сигнал то формируется, то гаснет до вхождения транспортного средства в поворот и во время его осуществления. Отсюда можно выделить 4 функции прерывателей:

  1. Создание уже упомянутого прерывистого светового сигнала указателей на одной из сторон автомобиля до и во время осуществления маневра;
  2. Создание прерывистого сигнала уже сигнальной лампы, размещенной на приборной панели авто;
  3. Формирование прерывистых сигналов абсолютно всех указателей, которыми оборудован автомобиль, при включении аварийной сигнализации;
  4. Формирование аналогично прерывистого, но уже звукового сигнала – щелчков – призванного помочь водителю ориентироваться в работе устройств без непосредственного визуального контакта с приборной панелью.

Для полного понимания работы реле-прерывателей стоит рассмотреть как современные устройства, так и их предшественников. Что касается последних, то в качестве последних возьмем электромагнитно-тепловые реле, которые устанавливались на классические автомобили ВАЗ. Более современные электронные прерыватели стоят на всех современных автомобилях, так что брать в качестве примера конкретное устройство с конкретной модели автомобиля нет смысла.

Подробнее об электромагнитно-тепловых реле

Такое реле призвано быть простым и надежным, хотя недостатков оно не лишено. Владельцы некоторых особенно старых автомобилей ВАЗ меняли его от силы один-два раза. Все дело в надежной конструкции реле, являющейся своеобразной метаморфозой устройств, использующихся в промышленных установках. Ключевыми элементами такого реле являются следующие:

  • Цилиндрический сердечник, имеющих обмотку из особенно тонкого медного провода;
  • Две контактные группы в верхней части сердечника;
  • Металлические якоря по бокам;
  • Металлический корпус.

Контактных групп две, причем первая отвечает за замыкание цепи контрольной лампочки поворотников авто на приборной панели, а вторая группа – непосредственно за цепь лампочек указателей поворота. В нормальном состоянии цепь указателей поворотов нормально разомкнута, т.к. якорь контактной группы оттянут нихромовой нитью. Нить зафиксирована на изоляционном материале, из которого также выполнена площадка для установки сердечника. В этой же нити действует ток – она подключена к цепи выключателя указателей.

Работает электромагнитно-тепловое реле по довольно простому принципу. Как только поступает сигнал о вхождении в поворот, цепь замыкается. В цепь входят лампочки поворотников, обмотка реле, резистор и нихромовая нить. Резистор нужен для уменьшения тока. Как только материал (нихром) начинает нагреваться, выполненная из него нить начинает растягиваться. Так как якорь оттянут нитью, постепенно увеличивающейся в длине, он сможет замкнуть контактную группу спустя некоторое время. Теперь ток начинает действовать в обход как нихромовй нити, так и резистора – он попросту начинает «течь» в обход участков с большим сопротивлением. Это означает, что лампы указателей поворотов начинает гореть не в пол накала, а в полную силу. Здесь важно отметить, что нихромовая нить нагревается и остывает очень быстро. За счет этой ее особенности лампы могут мигать 60-120 раз в минуту. Как читатель наверняка догадался, размыкание контактов обусловлено тем, что нить успевает быстро остыть и оттянуть якорь от сердечника. При подаче сигнала все повторяется.

Зачем же в реле предусмотрено две контактные группы? Все очень просто. Дело в том, что одно положении контактной группы напрямую влияет на работу второй контактной группы. Как только контакты первой группы разомкнуты, якорь во второй группе не может ее замкнуть. Когда сила тока возрастает и нить растягивается, первая контактная группы замыкается, что является условием для притяжения якоря во второй группе. Как результат, мигать начинают и указатели поворота, и сигнальная лампа, установленная на приборной панели.

Что касается звуковых сигналов, то и здесь все просто: якорь замыкает и размыкает цепь не плавно, а довольно резко, вследствие чего водитель и пассажиры могут слышать глухие щелчки. Это особенность работы электромагнитных реле, которая позволила сэкономить на дополнительных устройствах звукового оповещения. Корпус реле выполнен из металла и имеет цилиндрическую форму. На дне цилиндра находится уже упомянутая площадка, имеющая изоляционные свойства. Через нижнюю часть площадки выводятся контакты, которые должны быть включены в цепь указателей поворотов.

Устройство электронного реле

Чтобы лучше понимать принцип работы электронного реле, лучше разобраться с особенностями электромагнитно-теплового реле. Вот например: в первом устройстве нихромовой нить есть, но во втором ее функции выполняет электронный ключ. Во всех электронных реле можно разделить два компонента:

  1. Непосредственно электромагнитное реле, отвечающее за замыкание и размыкание цепи;
  2. Электронный ключ, обеспечивающий срабатывание реле со строго определенной частотой.

Вышеуказанный электронный ключ имеет в своей основе микросхему или множество транзисторов, на профессиональном языке еще называемых дискретными элементами. Такая основа образует цепи управления и задающий генератор. А все ради одного: подача и снятие напряжения с обмотки уже знакомого нам электромагнитного реле.

Работает система относительно просто. Как только на реле подается напряжение, в работу включается задающий генератор. Он формирует управляющие импульсы определенной частоты, которые подаются на цепи управления. Последние подают или прерывают ток, поступающий от обмотки реле. Когда в обмотке действует ток, якорь реле притягивается, тем самым замыкая пару контактных группы. В этот момент указатели поворотов и сигнальная лампочка загораются. Как только ток прекращает свое действие, якорь отходит в свое начальное положение и обе контактные группы размыкаются. Электронные реле все же вытеснили своих электромагнитно-тепловых «собратьев». Тому есть несколько причин, о которых ниже. А пока советуем обратить внимание на изображение – это простейшая схема, в которой реализовано реле поворотов. Понимание схемы окажется полезным при ремонте сломавшегося реле.

Дело в том, что электронные реле практически не подвержены действию как внешних, так и внутренних факторов. Их электромагнитно-тепловые предшественники со временем сильно нагревались, что приводило к изменению параметров отдельных токопроводящих элементов. Кроме того, электронные реле потребляют очень мало энергии – в случае нагрева нихромовой нити энергии требовалось куда больше. Такое реле попросту надежнее и его легко ввести в систему с аварийной сигнализацией.

Неисправности реле поворотов

Очевидным признаком неисправности реле являются неработающие указатели. В действительности же вариантов, при которых вскоре удастся диагностировать поломку реле, бывает несколько. Вот основные:

  • Лампы указателей поворотов постоянно горят (не наблюдается мигание). В этом случае поломка вызвана выходом из строя электромагнитной части реле. Обусловлена аномальная работа световых указателей тем, что контакты постоянно находятся в замкнутом положении. Зачастую они оказываются пригоревшими;
  • Лампы указателей перестали гореть. Необходимо проверить переключатель поворотов, само реле, а также удостовериться в том, что цепь не оборвана, а предохранитель не перегорел. Советуем начинать проверку с последнего;
  • Лампы начали мигать часто, или, напротив, слишком редко. Для начала стоит удостовериться в том, что потребление лампами тока соответствует номиналу. Если одна лампа перегорела или же потребляет меньший ток, чем необходимо, то поворотники начнут мигать слишком часто. Аналогичная проблема наблюдается при окислении цоколя или патрона лампы, а также при обрыве провода к одной из установленных ламп. При установке слишком мощных ламп они будут мигать реже обычного. Если проблема кроется не в лампах, необходимо проверять реле и состояние контактов в цепи питания.

Нельзя забывать о том, что на неисправность реле указывают и некоторые другие вещи. Например, при работе устройство может издавать нехарактерный треск. В некоторых случаях неисправное реле может влиять на работу светового оповещения при срабатывании аварийной сигнализации – частота мигания будет не такой, как в обычных условиях. Как показала практика, часто неисправности указателей поворотов связаны с установкой неподходящих ламп, а также с обрывом цепи, перегоранием предохранителя и пригоранием контактов реле. Советуем с особым вниманием относиться к светодиодным лампам – если они планируются к установке вместо обычных ламп накаливания, стоит обратиться к специалисту.

Ремонт и замена реле поворотников

Для начала стоит определиться с тем, где реле поворотов установлено. В одних автомобилях его можно найти прямо за приборной доской – оно расположено чуть правее. В других авто реле устанавливается прямо в монтажном блоке. Если вы не уверены в том, где именно находится устройство и как оно крепится, подготовьте следующие инструменты:

  • Ключ-головка на «10»;
  • Пассатижи;
  • Крестовая отвертка;
  • Пластиковый съемник.

Как только реле было демонтировано, проверьте состояние проводки и контактов. Если есть желание осуществить ремонт реле, то необходимо сделать следующее:

  • Очистить контактные пластины от нагара. Зачастую это удается сделать куском обычного ластика;
  • Обратите внимание на металлическую U-образную перемычку. Если она покрыта толстым слоем нагара или даже сломалась, ее придется заменить. Как показала практика, на ее место можно впаять несколько жил от медного кабеля;
  • Если вы видите трещины в силовых выводах, то их нужно подпаять. В случае обрыва контактов выходом из ситуации также станет пайка.

Если вы всерьез настроены отремонтировать старое реле, то вам понадобится реле-донор с теми же характеристиками. Причем случайно найденное в магазине реле не подойдет. Придется найти техническую документацию родного устройства и подходящего донора. К несчастью, многая информация о ремонте реле, равно как и техническая документация, может быть найдена только на англоязычных сайтах. В первую очередь вас должна интересовать такая графа как “Characteristics” и ее следующие пункты: Contact Rating; все 3 параметры Max. switching; Operate Time; оба параметра Endurance; Initial Insulation Resistance. Также обратите внимание на таблицу Coil Data. Чем больше будет совпадений с параметрами вышедшего из строя реле, тем дольше оно прослужит после ремонта с использованием компонентов донора. Также отметим, что если вы хотите адаптировать имеющееся реле под использование в цепи со светодиодными поворотниками, без пайки никак не обойтись. В этом случае лучшим решением будет подрезание цепи измерения тока и пайка дополнительного многооборотного резистора, хотя можно обойтись и обычным резистором для шунта – подходящий будет сложнее найти, но он тоже подойдет.

Поиск нового реле

Если вариант с ремонтом сломанного реле вам не подходит, то стоит сразу же приступить к поиску нового устройства. На самом деле это решение является самым простым и надежным, хотя пытливый ум автолюбителя и тягу к экспериментам он не удовлетворит. Новое реле стоит небольших денег, а на современном рынке автозапчастей нетрудно будет найти подходящий аналог. Вести поиски можно по:

  • VIN-коду авто;
  • Коду имеющегося и вышедшего из строя реле или кодам его аналогов;
  • Параметрам авто.

Практика показывает, что сегодня автолюбители все чаще ищут нужные запчасти по параметрам своего транспортного средства. В частности, важны марка, модель и год выпуска. Современные интернет-магазины с их кросс-базами кодов позволяют быстро подбирать как оригинальное реле, так и его аналоги. Особняком стоит подбор реле по ключевым параметрам, часть которых мы указали в предыдущем пункте. При поиске по параметрам самого реле легко ошибиться (а то и вовсе не найти полную документацию), но в случае успеха вы сможете найти или тот же оригинал, или полностью идентичный ему аналог.

Вывод

Реле поворотов – небольшой, но крайне важный компонент системы светового оповещения авто. Оно позволяет водителю быть более предсказуемым для других участников движения, что, разумеется, наилучшим образом сказывается на безопасности движения и в некоторой мере на комфорте. При выходе реле из строя проблему игнорировать ни в коем случае нельзя. К счастью, реле не относится к дорогим компонентам световых систем, так что автолюбитель может практически без ущерба для бюджета взять сразу два устройства – второе будет лежать в багажнике, гараже или дома про запас. Именно так мы и советуем поступать.


Системы управления двигателем. Системы управления двигателем КамАЗ 6460 лампочка диагностики мигает

Серьезный автомобиль ведет себя неадекватно? Капризы вашего грузовика могут разрушить деловые соглашения и привести к длительному простою, опустошив ваш кошелек. В этой статье мы покажем вам, как диагностировать проблемы на ранней стадии, чтобы вы могли начать устранять проблемы как можно раньше.

[Скрыть]

Электронные системы управления КАМАЗ

В последнее время двигатели Камского автозавода стали классифицировать по принадлежности к тому или иному классу экологичности (от Евро-0 до Евро-4).Техническая реализация класса Евро-3, а затем Евро-4, принятого с 2013 года, оказалась невозможной без использования электронных систем управления двигателем (ЭСУД). Именно это привело к возможности производить с использованием универсальных.

Автомобили КАМАЗ различной комплектации оснащались двигателями с электронными блоками управления (ЭБУ). И если сейчас водителя беспокоит нездоровое поведение при эксплуатации известных грузовиков, появились симптомы в виде плавающих оборотов, потери тяги, посторонних шумов, повышенного расхода дизельного топлива, на помощь приходит самодиагностика.

С помощью вывода информации с ЭБУ в виде кода ошибки можно указать точную диагностику электрооборудования КАМАЗ. Процесс диагностики и расшифровки кодов зависит от типа электронной системы, установленной на грузовике. Перед началом диагностики предлагается определить тип ЭБУ по установленной модели двигателя.


Самодиагностика Независимо от того, какая фирма производила ваш V8, Cammins Inc. (Камминз) или ООО КАМАЗ устанавливала на него системы подачи топлива от Common Rail и системы рециркуляции отработавших газов (EGR) или системы нейтрализации (SCR), будет проведена диагностика в соответствии с этими двумя типами.

Процесс самодиагностики электронных систем КАМАЗ двигателей Евро-3, -4 несколько отличается от аналогичной процедуры на других автомобилях. После нажатия определенной кнопки один из сигнализаторов или блок начнет мигать с разной периодичностью, количество вспышек лампы одного интервала определяет разряд кода.

Двигатель с ЭБУ BOSCH MS 6.1

Итак, устраиваемся в кабине нашего КАМАЗа, далее включаем зажигание поворотом ключа как обычно.Вместе со многими другими индикаторами загорается контрольная лампа диагностики или «Check Engin», в простонародье — подводная лодка. Лампа загорается на 3 секунды и гаснет, тем самым демонстрируя свою работоспособность и исправность ЭБУ. Если лампа не гаснет или загорается при работающем двигателе, в электронной системе обнаружена неисправность!


Обратите внимание на качельку режима диагностики (часто устанавливается на панели приборов слева, под рулем) или кнопку этого режима (часто находится рядом с блоком предохранителей, под панелью напротив сиденья пассажира) .«Качалка» имеет два крайних положения для удержания и центральное фиксированное положение.

Опускаем качельку в крайнее верхнее или нижнее положение и удерживаем там более двух секунд. Просто нажмите кнопку и не отпускайте указанное выше время. После того, как «качелька» или кнопка вернется обратно, диагностическая лампа будет мигать сначала длинными интервалами, а потом короткими. Количество длинных вспышек определяет первый бит кода ошибки, количество коротких – второй.


На схеме показан пример получения кода 24. Соотносим код ошибки (иначе блинк-код, от англ. blink – моргать) с приведенной ниже таблицей.

Коды ошибок ЭБУ BOSCH MS6.1 двигателей эко-класса Евро-3
Код ошибки Описание неисправности Ограничения работы, установленные ЭБУ
11 педаль газа скорость двигателя ограничена
1900 об/мин
12, 13 датчик атмосферного давления без ограничений
14 датчик сцепления скорость двигателя ограничена
1900 об/мин
15 датчик частоты вращения коленчатого вала частота вращения двигателя ограничена
1600 об/мин
16, 17 Неправильная полярность датчиков частоты вращения
датчики установлены неправильно
обороты двигателя ограничены
1800 об/мин
18 датчик частоты вращения распределительного вала частота вращения двигателя ограничена
1800 об/мин
19 главное реле без ограничений
21, 22, 24-26 Топливный насос высокого давления Ошибка запуска двигателя
23 несоответствующее положение педалей газа и тормоза не ограничено
27 плохой контакт датчика положения рейки отказ запуска двигателя
28 датчик педали тормоза не ограничено
29, 51-53, 81-86, 99 электронный блок управления отказ запуска двигателя
31, 32 датчик температуры воздуха без ограничений
33, 34 датчик давления воздуха без ограничений
35 Модуль круиз-контроля без ограничений
36, 37 Датчик температуры жидкостного охлаждения Обороты двигателя ограничены
1900 об/мин
38, 39 Датчик температуры топлива Обороты двигателя ограничены
1900 об/мин
41 сигнал с многоступенчатого входа не соответствует эталону не ограничено
42 превышена максимальная скорость двигателя возможно, была выбрана неправильная передача. Сброс ошибки
при повторном запуске двигателя
43 ошибка сигнала скорости частота вращения двигателя ограничена
1500 об/мин
54 превышение бортового напряжения не ограничено
55 цикл работы блока управления не завершен корректно не ограничено
61-67 Линия CAN без ограничений

Нередко компьютер регистрирует несколько ошибок, для просмотра следующего кода повторите вышеописанные действия кнопкой или “качелькой”.Коды ошибок будут воспроизводиться циклически. В памяти ЭБУ фиксируется не более пяти неисправностей. Для удаления всех ошибок из памяти блока управления необходимо включить зажигание и удерживать «качельку» в течение пяти секунд. Таким образом можно временно избавить автомобиль от тревожных симптомов в виде электронных ограничений.

Двигатель с ЭБУ ISB CM2150


Данный тип ЭБУ устанавливался на более поздние модели КАМАЗ и диагностика в этом случае будет отличаться от приведенной схемы. После включения зажигания в память электронного блока записывается действующая на данный момент неисправность, кроме того неисправность может сигнализироваться красной или желтой контрольной диагностической лампой.


После нажатия на «качельку» в любом крайнем положении более двух секунд будет выдан код неисправности с полусекундным интервалом между вспышками одной из двух ламп. Цифры кода ошибки разделены двухсекундной паузой. В отличие от ЭБУ предыдущего типа, результирующий код будет трех- или четырехзначным!

Соотносим код ошибки с таблицей ниже.Цвет линий в таблице соотносится с цветом контрольной диагностической лампы. Красный цвет индикации указывает на невозможность начать или продолжить движение при данной неисправности, желтый цвет указывает на необходимость устранения неисправности после окончания движения на автомобиле.

Коды ошибок ЭБУ ISB CM2150 для двигателей эко-класса Евро-3
111 Критическая неисправность внутри модуля управления двигателем – интеллектуально-программируемая часть или ее компонент работает некорректно 422 Уровень охлаждающей жидкости – Получены ошибки 689 Ошибка датчика первичной частоты вращения двигателя – приходят ошибки
115 Потеря пары сигналов электромагнитного датчика в цепи датчика частоты вращения (положения) двигателя – получены ошибки 425 Температура смазки двигателя — получены неверные данные 1139 Цилиндр форсунки №1 – механическая система работает неправильно или не отрегулирована
143 Низкое давление масла – вероятно, но ниже оптимального рабочего диапазона 428 Вода в цепи датчика топлива – напряжение выше нормы, либо цепь замкнута на источник высокого напряжения 1141 Цилиндр форсунки №2 – механическая система работает неправильно или не отрегулирована
146 Температура охлаждающей жидкости выше нормы — хорошо, но выше оптимального рабочего диапазона 429 Попадание воды в цепь датчика топлива – напряжение выше нормы, либо цепь замкнута на источник низкого напряжения 1142 Цилиндр форсунки №3 – механическая система работает неправильно или не отрегулирована
151 Температура охлаждающей жидкости ниже нормы — хорошо, но выше оптимального рабочего диапазона 431 Цепь проверки холостого хода, педаль акселератора или рычаг – получены ошибочные данные 1143 Цилиндр форсунки №4 – механическая система работает неправильно или не отрегулирована
197 Уровень охлаждающей жидкости — действителен, но ниже оптимального рабочего диапазона 432 Цепь проверки холостого хода, педаль или рычаг дроссельной заслонки — не откалиброваны 1144 Цилиндр форсунки № 5 — механическая система неисправна или не отрегулирована
214 Температура моторного масла – хорошая, но выше оптимального рабочего диапазона 433 Цепь датчика давления во впускном коллекторе – получены неверные значения 1145 Цилиндр форсунки № 6 — механическая система неисправна или не отрегулирована
233 Давление охлаждающей жидкости — допустимое, но ниже оптимального рабочего диапазона — умеренно тяжелое 434 Сбой питания без выключения зажигания (Ignition Off) – получены ошибки 2265 Сигнальная цепь управления пусковым насосом – напряжение выше нормативного, либо замыкание на источник высокого напряжения
234 Высокие обороты двигателя – хорошие данные, но выше оптимального рабочего диапазона 435 Цепь – приходят ошибки 2266 Сигнальная цепь управления насосом проворачивания коленчатого вала – напряжение ниже нормы или короткое замыкание на источник низкого напряжения
235 Недостаток охлаждающей жидкости – действителен, но ниже оптимального рабочего диапазона 441 Низкое напряжение батареи № 1 — допустимо, но ниже оптимального рабочего диапазона 2292 Устройство учета топлива – достоверные данные, но выше оптимального рабочего диапазона
245 Цепь управления вентилятором — слишком низкое напряжение или короткое замыкание на низкое напряжение 442 Аккумулятор № 1, высокое напряжение — хорошее, но выше оптимального рабочего диапазона 2293 Устройство дозирования топлива — Требуемый расход ниже ожидаемого — Действительно, но ниже оптимального рабочего диапазона
261 Температура топлива в двигателе – достоверная, но выше оптимальных условий эксплуатации 449 Высокое давление топлива – хорошее, но выше оптимального рабочего диапазона 2377 Цепь управления вентилятором – напряжение выше нормы или короткое замыкание на источник высокого напряжения
275 Элемент впрыска топлива (передний) – механическая система работает неправильно или не отрегулирована 595 Турбокомпрессор № 1, высокая скорость — действителен, но выше оптимального рабочего диапазона 2555 Цепь нагревателя впускного воздуха №1 – напряжение выше нормы или короткое замыкание на источник высокого напряжения
281 Топливный клапан высокого давления №1 с электромагнитным управлением – механическая система работает неправильно или не отрегулирована 596 Зарядка Электрическое высокое напряжение — хорошее, но выше оптимального рабочего диапазона 2556 Цепь подогревателя впускного воздуха №1 – напряжение ниже нормы или короткое замыкание на источник низкого напряжения
351 Источник питания форсунки – неисправность (интеллектуально программируемое) устройство или компонент 598 Низкое напряжение системы зарядки — допустимо, но ниже оптимального рабочего диапазона 2558 Вспомогательный ШИМ (широтно-импульсная модуляция) № 1 Триггер — слишком низкое напряжение или короткое замыкание на низкое напряжение
415 Низкое давление масла — допустимо, но ниже оптимального рабочего диапазона 687 Низкая скорость турбонагнетателя № 1 — действительна, но ниже оптимального рабочего диапазона 2973 Цепь датчика давления во впускном коллекторе – получены неверные данные

Если вы не нашли в таблице марку вашего двигателя или код ошибки ЭБУ ISB CM2150, обязательно напишите нам, и мы сразу же постараемся помочь.

Служит для контроля работы двигателя и выдачи кодов неисправностей – блинк-кодов ( см. Таблицу кодов неисправностей (Блинк-коды )).

  • Первая цифра мигающего кода – это количество длинных вспышек диагностической лампы;
  • Вторая цифра мигающего кода – это количество коротких вспышек диагностической лампы.

Таблица кодов неисправностей двигателя (коды бликов)

Неисправность педали газа

нмакс = 1900 об/мин

Проверьте соединение педали газа.
Обратитесь в сервисный центр

Неисправность датчика
атмосферного давления
(датчик встроен в электронный блок управления
)

Нмакс ≈ 300 л.с.

Вы можете продолжать движение.
Обратитесь в сервисный центр

Физическая ошибка датчика
Атмосферное давление

Неисправность
Датчик сцепления

Нмакс = 1900 об/мин

Проверьте датчик сцепления.
Вы можете продолжать движение.
Не используйте функцию круиза.
контроль.

Неисправность основного
датчика частоты вращения
двигателя (коленвала)
)

нмакс = 1600 об/мин

Проверить состояние и подключение
соответствующих датчиков частоты
вращения двигателя.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Неправильная полярность или
перестановка датчиков частоты
вращение

nмакс = 1800 об/мин nмакс = 1900 об/мин

Неисправность вспомогательного
датчика скорости
электродвигателя (распредвала)
( )

нмакс = 1800 об/мин

Неисправность основного
электронного реле
блока управления

Проверьте главное реле и его соединения.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Неисправность топливного насоса

Возможно двигатель
не запустится.


Срочно обратитесь в сервисный центр.

Несоответствие положения
педали газа и педали тормоза

Нмакс≈200 л.с.

Проверьте педаль газа, возможно заедает.
Срочно обратитесь в сервисный центр.

Плохой контакт датчика
положения рейки (датчик
встроен в исполнительный механизм
ТНВД)

Возможно двигатель
не запустится.

Проверить контакт штекера ТНВД.
Срочно обратитесь в сервисный центр!

Неисправность датчика
Педаль тормоза

Нмакс≈200 л. с.

Проверьте датчик педали тормоза и тормозное реле.

Вы можете продолжать движение. Обратитесь в сервисный центр.

Электронная неисправность
блока управления (аппаратное обеспечение
безопасности)

29, 51-53, 81-86,

Возможно двигатель
не запустится.

Неисправность датчика
Температура наддува
Воздух

Нмакс ≈ 300л.с.

Проверить датчик температуры наддувочного воздуха
.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
Температура наддува
Воздух

Неисправность датчика
Давление наддувочного воздуха

Нмакс ≈ 250 л. с.

Проверить датчик давления
наддувочного воздуха.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
Давление наддувочного воздуха

Неисправность модуля
Круиз-контроль

Проверить соединение рычага
круиз-контроля.
Вы можете продолжать движение.
Обратитесь в сервисный центр.
Эта ошибка также появляется из-за
одновременного нажатия нескольких
элементов управления рычагом круиз-контроля.

Неисправность датчика
Температура охлаждения
жидкости

Проверить датчик температуры охлаждающей жидкости
.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
температура охлаждения
жидкость (

Нмакс ≈ 30 л.с.

нмакс = 1900 об/мин

Неисправность датчика
температуры топлива ( )

нмакс = 1900 об/мин

Проверьте датчик температуры топлива.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
температура топлива

Неправильный сигнал от многоступенчатого входа

Вы можете продолжать движение.
Обратитесь в сервисный центр.

Превышение максимальной
допустимой частоты
оборотов двигателя

После полной остановки двигателя

возможен новый запуск

Если превышение произошло из-за
неправильного переключения передач с
с высшей на низшую: проверьте двигатель;
если двигатель в порядке, вы можете запустить двигатель
и продолжать движение.
Если двигатель самопроизвольно увеличил
обороты, не запускайте двигатель!
Срочно обратитесь в сервисный центр!

Ошибка сигнала скорости
автомобиль

нмакс = 1550 об/мин

Проверить подключение тахографа к электронному блоку управления
.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Избыток переносимых по воздуху
стрессов

Проверить зарядку
аккумулятора.

Неправильно закончен
рабочий цикл электронного
блока управления

Данная ошибка появляется из-за
отключения массы раньше 5с после
выключения зажигания или прерывания
питания электронного блока управления.
Вы можете продолжать движение.
Обратитесь в сервисный центр

Неисправность линии CAN

Проверить подключение линии CAN к
другим устройствам CAN
(ABS, АКПП и т.д.).
Вы можете продолжать движение.
Обратитесь в сервисный центр

АБС имеет встроенную самодиагностику, система постоянно контролирует собственную работоспособность. Для принудительной функциональной проверки в целях устранения неполадок необходимо использовать режим принудительной диагностики.

Включение электронного блока в режим принудительной диагностики осуществляется нажатием и удержанием в течение 1 – 2 секунд кнопки диагностики АБС (см. рис. Щиток приборов) при включенных массе и выключателе стартера и приборов (блокировка ротор необходимо повернуть ключом в положение «I».

При этом, если перед входом в режим диагностики лампочка диагностики горела (что свидетельствует о наличии активных ошибок, т.е. ошибок или неисправностей, присутствующих на момент диагностики), то при нажатии на кнопку она гаснет примерно на 1 секунду, а затем циклически повторяющийся активный код ошибки каждые 4 секунды до устранения данной неисправности.

Светомигающий код активной ошибки о характере неисправности и неисправном элементе системы состоит из двух информационных блоков, представляющих собой два блока световых вспышек.Продолжительность каждой вспышки 0,5 секунды, пауза между вспышками 0,5 секунды, между блоками – 1,5 секунды. Неисправный элемент и характер неисправности определяют по количеству вспышек диагностической лампы соответственно в первом и втором блоках по таблице Световые коды состояния элементов АБС. При отсутствии отказов или неисправностей выдается световой код 1-1 (по одному миганию контрольной лампы в каждом информационном блоке). Если активных ошибок в системе несколько, то после устранения первой ошибки будет выдан световой код второй активной ошибки и т.д.(до устранения всех неисправностей).

После устранения всех активных ошибок необходимо повернуть ротор блокировки ключом в выключателе стартера и приборов ключом сначала в положение «0», а затем в положение «I».

Если активных ошибок нет, то в режиме диагностики последовательно (каждые 4 секунды) выдаются световые коды последних 4-х пассивных или “плавающих” ошибок. ошибки, которые были, но на момент диагностики отсутствуют (или остались не стертыми в памяти блока).Информация о пассивных ошибках отображается 1 раз. Для повторного вывода светового кода пассивных ошибок необходимо повторно нажать кнопку диагностики, как описано выше.

КамАЗ 65115. Режим управления системой ABS

В системном режиме возможно определение конфигурации системы, стирание последних четырех (пассивных) ошибок из памяти электронного блока, а также перенастройка системы.

Для включения системного режима нажмите кнопку диагностики (см.Щиток приборов) и удерживать его во включенном состоянии от 3,0 до 6,3 сек. При активации системного режима автоматически стираются все пассивные ошибки, если они были в памяти блока. Об этом будет свидетельствовать 8 быстрых (длительностью 0,1 секунды) вспышек диагностической лампы. Если есть активные ошибки, то указанных вспышек не последует, а код конфигурации будет выдан сразу.

Световой код конфигурации выдается после включения системного режима (на автомобилях КамАЗ установлена ​​система 4S/4M 4 датчика/4 модулятора), количество вспышек лампы должно быть равно 2 (две световые вспышки продолжительностью 0.5 секунд с паузой 1,5 секунды). Код конфигурации повторяется каждые 4 секунды. Для выхода из системного режима необходимо выключить, а затем включить блокировку стартера и переключателя приборов в положение «приборы» или нажать кнопку диагностики на время от 6,3 до 15 секунд. При этом вывод световых кодов на диагностическую лампу прекращается.

Если стереть код неисправности сложно (после многократного повторения операций стирания сохраняется один и тот же код), необходимо еще раз убедиться в устранении соответствующей неисправности и повторять операции до получения кода 1-1.

Световые коды состояния элементов АБС

Ра – РБ
1 – 1 Все элементы в порядке.
2 – 1
2 – 2
2 – 3
2 – 4
Модулятор B
Модулятор A
Модулятор D
Модулятор C
Обрыв или короткое замыкание на массу.

Обрыв или короткое замыкание на массу.
Обрыв или короткое замыкание на массу.

Проверьте соединительные кабели, подключение к блоку и модулятору.
Устранение повреждений.
Если повреждений нет, замените модулятор.
3 – 1
3 – 2
3 – 3
3 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Большой воздушный зазор
Большой воздушный зазор
Большой воздушный зазор
Большой воздушный зазор
Отрегулируйте зазор между датчиком и ротором.
Максимальный зазор равен 1.3 мм.
4 – 1
4 – 2
4 – 3
4 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Короткое замыкание или обрыв

Короткое замыкание или обрыв
Короткое замыкание или обрыв

Проверить датчик, соединение с блоком и датчик, кабель датчика
на обрыв или короткое замыкание. Устранять.
Замените датчик.
5 – 1
5 – 2
5 – 3
5 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Прерывистый сигнал
Прерывистый сигнал
Прерывистый сигнал
Прерывистый сигнал
Проверить кабель и уровень сигнала датчика при пробуксовке колес

Проверить целостность ротора.

6 – 1
6 – 2
6 – 3
6 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Неисправный ротор/датчик
Неисправный ротор/датчик
Неисправный ротор/датчик
Неисправный ротор/датчик
Замените датчик или ротор.
7 – 1 Связь с БУ Ошибка связи Проверьте проводку. Устраните неисправность
(см.Принципиальная схема подключения АБС).
Проверить блок управления, при неисправности заменить.
7 – 3 Реле вспомогательного тормоза Проверить кабель реле на обрыв или короткое замыкание. Устранять.
Проверьте работоспособность реле.
7 – 4 Лампа диагностики АБС Короткое замыкание или обрыв Проверить кабель лампы на обрыв или короткое замыкание. Устранять.
Убедитесь, что лампа работает правильно.
8 – 1 БУ блок питания Пониженное напряжение бортовой сети Проверьте аккумуляторы и предохранители. Обеспечить напряжение 24-28В
(см. рис. Принципиальная схема подключения АБС).
8 – 2 БУ блок питания Перенапряжение бортовой сети Проверить реле напряжения бортовой сети.
Замените при необходимости.
8 – 3 БУ Внутренняя ошибка Заменить БУ
8 – 4 БУ Ошибка конфигурации Заменить БУ
8 – 5 БУ блок питания Ошибка подключения массы Проверьте правильность подключения.Устранить неисправность

Поиск и устранение неисправностей

Причиной неисправности тормозной системы может быть отказ в работе пневматических устройств, нарушение регулировок, а также утечка сжатого воздуха в пневмоприводе из-за негерметичности соединений трубопроводов и гибких шлангов. Утечки в цепях пневмопривода сигнализируются люминесцентными сигнальными лампами (см. рис. Панель приборов и блоки контрольных ламп) и зуммером. Когда давление в контурах превышает 450-550 кПа (4.5-5,5 кгс/см2), лампы должны погаснуть, и одновременно должен перестать звучать зуммер. Время заполнения ресиверов сжатым воздухом до номинального давления не должно превышать 8 мин при номинальной частоте вращения двигателя.

Проверить герметичность пневмопривода при номинальном давлении, включенных потребителях сжатого воздуха и неработающем двигателе. Найдите крупные утечки воздуха на слух. Незначительные утечки можно обнаружить, покрыв соединения трубопроводов мыльной эмульсией.

При поиске неисправностей использовать Схемы пневмопривода тормозных систем, , на которых условно показаны тормоза и соединяющие их трубопроводы.

Пневматические тормозные системы одиночных автомобилей КАМАЗ моделей 53229, 55111, 6511 5

1 – водоотделитель;
2 – компрессор;
3 – охладитель;

6 – регулятор давления;

8 – кран тормозной;

14 – манометр;

16 – приемник контура IV
17 – приемник контура II;
18 – клапан слива конденсата;

20.24 – клапаны ускорительные;

23 – приемники III контура;
25 – приемник контура I;

28 – модуляторы АБС;
29 – Датчик скорости АБС;

Пневматическая тормозная система автомобилей КАМАЗ моделей 55111, 65115 работающая с прицепом

1 – водоотделитель;
2 – компрессор;
3 – охладитель;
4 – Клапан предохранительный четырехконтурный;
5 – автоматический регулятор тормозных сил;
6 – регулятор давления;
7 – выключатель тормозного сигнала;
8 – кран тормозной;
9 – пневмоцилиндры привода заслонки вспомогательной тормозной системы;
10 – кран управления стояночным тормозом;
11 – клапан пропорциональный;
12 – пневмоцилиндр привода рычага остановки двигателя;
13 – кран управления вспомогательной тормозной системой;
14 – манометр;
15 – передняя тормозная камера;
16 – приемник контура IV;
17 – приемник контура II;
18 – клапан слива конденсата;
19 – задняя тормозная камера;
20, 24 – клапаны ускорительные;
21 – клапан перепускной двухлинейный;
22 – выключатель контрольной лампы стояночной тормозной системы;
23 – ресиверы III контура;
25 – приемник контура I;
26 – выключатель контрольной лампы падения давления воздуха в контуре III;
27 – клапан аварийного сброса;
28 – модуляторы АБС;
29 – Датчик скорости АБС;
30 – влагомаслоотделитель с регулятором давления;
31 – кран управления тормозами прицепа;
32 – головки автоматические соединительные;
А, В, С, D – клапаны управляющих выходов.

Коды ошибок КамАЗ Евро-4 – это информация о неполадках в работе автомобиля.

Как проводится диагностика?

Диагностика включает в себя сбор признаков неисправностей в системе, сканирование электронной системы управления, сброс и проверку всех механизмов и систем на наличие неисправностей в электронном блоке, обследование всех датчиков, отвечающих за бесперебойную работу силового агрегата.

При диагностике КамАЗ-5490, 54115, 5308 и других моделей с двигателем, изготовленным по международному экологическому стандарту Евро-3 и 4, измеряют уровень давления в топливной системе, проверяют работоспособность генераторной установки и анализируют выхлопные газы с помощью специального оборудования.Также проверяют обмотку электромагнитного регулятора системы подачи топлива и КЗ в катушках индуктивных датчиков.

Аппаратное и программное обеспечение для диагностики

Есть несколько сканеров для выявления проблем в механизмах автомобиля, например:

  1. Автосканер ДК-5. Данное оборудование помогает выявлять неисправности в работе электронного блока путем считывания и корректировки показателей системы управления с помощью компьютера. Данный автосканер можно использовать при температуре до +30°С и относительной влажности не выше 80%.
  2. Сканер
  3. ЭДС-24. Это программно-аппаратный комплекс, предназначенный для компьютерной диагностики грузового автомобиля. Он включает гальванически изолированный USB-адаптер, который позволяет тестировать системы в условиях низкого напряжения.

Диагностические программы:

  • Евроскан;
  • Сканматик-2;
  • АВТОАС-КАРГО.


Ошибки декодирования

Расшифровка кодов ошибок КамАЗ представлена ​​в инструкции к программе, которая используется для диагностики.Примеры ошибок:

  • 213 – неисправность устройства управления силовым агрегатом;
  • 296 – упало давление масляной жидкости;
  • 2973 – неисправности в системе регулирования давления воздуха во впускном коллекторе;
  • 214 – перегрев масляной жидкости;
  • 235 – недостаточное количество охлаждающей жидкости в системе;
  • 425 – высокая температура масла;
  • 3617 – нет сигнала многоступенчатого переключателя;
  • ошибка 4335 – проблемы с подачей воздуха;
  • 275 – неправильно работает ТНВД;
  • 429 – показания высокого напряжения в цепи указателя уровня топлива;
  • 351 – нарушение в работе форсунок;
  • 415 – низкий уровень рабочей жидкости;
  • 261 – перегрев топлива.

См. » Все о ремонте и установке крана тормозного КамАЗ


Сломанные датчики

Коды неисправностей КамАЗ-34334, 6308 и др. моделей с двигателем Евро-4:

  • 221 – поломка датчика положения педали, отвечающего за подачу рабочей жидкости;
  • 232 – неисправность датчика, измеряющего атмосферное давление;
  • 335 – дефекты проводки выходного каскада управления лампами;
  • 231 – неисправность датчика давления наддува на ЭБУ;
  • 124 – исправление некорректного индикатора напряжения;
  • 345 – некорректная работа передачи сигнала от указателя давления ОГ;
  • 113 – проблемы с частотой вращения распредвала;
  • 112 – некорректные показатели, поступающие на блок управления от коленчатого вала;
  • 246 – неисправности датчика температуры;
  • 00550 – неисправность заглушки ТНВД.


Неисправности двигателя внутреннего сгорания

Список поломок ДВС на КамАЗе:

  • 726 FMI 2 – неисправности в работе указателя положения устройства, отвечающего за распределение жидкости;
  • СПН 526313 ФМИ 6 – брак устройства, контролирующего уровень давления в механизме рампы;
  • SPN 520211 FMI 12 – нет сообщения от системы АБС;
  • SPN 791 FMI 4 – низкий уровень заряда;
  • 523470-2 – нет напряжения в цепи механизма, отвечающего за сброс показателей давления;
  • СПН 523613 FMI 16 – изношены фильтры очистки рабочей жидкости;
  • 77 FMI 0 – высокие обороты двигателя;
  • 190-3 – неисправность;
  • 110-0 – высокий уровень температуры двигателя;
  • 132-4 – сбой в распределении воздушного потока;
  • 653-0 – повреждение в системе питания форсунок.


Прочие поломки

Кодовая таблица:

Коды системных ошибок Причина поломки
СПН 977 ФМИ 4 Неисправности в цепном механизме кондиционера
98-1 Превышено число оборотов коленчатого вала
523601-4 Низкий уровень топлива и масла
3514-31 Блок питания вышел из строя
675-4 Закрытые сопла
13688-4 Реле топливного насоса замкнуто на массу
91-4 Нечеткий сигнал датчика, отвечающего за положение тормозного механизма
171-3 Эта ошибка означает неисправность термометра.
1072-4 Клапан закорочен на массу
111-3 Сильный сигнал от указателя уровня антифриза
1188-5 Нет связи с реле подогрева воздушного потока
110-2 Датчик, следящий за температурой антифриза, работает некорректно
1188-4 Замыкание на массу в цепи управления клапаном давления

Системы управления двигателем.

Системы управления двигателем Проверка на КамАЗ 43118 осуществляется по

Служит для контроля работы двигателя и выдачи кодов неисправностей – блинк-кодов ( см. Таблицу кодов неисправностей (Блинк-коды )).

  • Первая цифра мигающего кода – это количество длинных вспышек диагностической лампы;
  • Вторая цифра мигающего кода – это количество коротких вспышек диагностической лампы.

Таблица кодов неисправностей двигателя (коды бликов)

Неисправность педали газа

нмакс = 1900 об/мин

Проверьте соединение педали газа.
Обратитесь в сервисный центр

Неисправность датчика
атмосферного давления
(датчик встроен в электронный блок управления
)

Нмакс ≈ 300 л. с.

Вы можете продолжать движение.
Обратиться в сервисный центр

Физическая ошибка датчика
Атмосферное давление

Неисправность
Датчик сцепления

Нмакс = 1900 об/мин

Проверьте датчик сцепления.
Вы можете продолжать движение.
Не используйте функцию круиза.
контроль.

Неисправность основного
датчика частоты вращения
двигателя (коленчатого вала)
)

нмакс = 1600 об/мин

Проверить состояние и подключение
соответствующих датчиков частоты
вращения двигателя.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Неправильная полярность или
перестановка датчиков частоты
вращение

nмакс = 1800 об/мин nмакс = 1900 об/мин

Неисправность вспомогательного
датчика скорости
электродвигателя (распредвала)
( )

нмакс = 1800 об/мин

Неисправность основного
электронного реле
блока управления

Проверьте главное реле и его соединения.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Неисправность топливного насоса

Возможно двигатель
не запустится.


Срочно обратитесь в сервисный центр.

Несоответствие положения
педали газа и педали тормоза

Нмакс≈200 л.с.

Проверьте педаль газа, возможно заедает.
Срочно обратитесь в сервисный центр.

Плохой контакт датчика
положения рейки (датчик
встроен в исполнительный механизм
ТНВД)

Возможно двигатель
не запустится.

Проверить контакт штекера ТНВД.
Срочно обратитесь в сервисный центр!

Неисправность датчика
Педаль тормоза

Нмакс≈200 л.с.

Проверьте датчик педали тормоза и тормозное реле.

Вы можете продолжать движение. Обратитесь в сервисный центр.

Электронная неисправность
блока управления (аппаратное обеспечение
безопасности)

29, 51-53, 81-86,

Возможно двигатель
не запустится.

Неисправность датчика
Температура наддува
Воздух

Нмакс ≈ 300л.с.

Проверить датчик температуры наддувочного воздуха
.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
Температура наддува
Воздух

Неисправность датчика
Давление наддувочного воздуха

Нмакс ≈ 250 л. с.

Проверить датчик давления
наддувочного воздуха.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
Давление наддувочного воздуха

Неисправность модуля
Круиз-контроль

Проверить соединение рычага
круиз-контроля.
Вы можете продолжать движение.
Обратитесь в сервисный центр.
Эта ошибка также появляется из-за
одновременного нажатия нескольких
элементов управления рычагом круиз-контроля.

Неисправность датчика
Температура охлаждения
жидкости

Проверить датчик температуры охлаждающей жидкости
.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
температура охлаждения
жидкость (

Нмакс ≈ 30 л.с.

нмакс = 1900 об/мин

Неисправность датчика
температуры топлива ( )

нмакс = 1900 об/мин

Проверьте датчик температуры топлива.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Ошибка физического датчика
температура топлива

Неправильный сигнал от многоступенчатого входа

Вы можете продолжать движение.
Обратитесь в сервисный центр.

Превышение максимальной
допустимой частоты
оборотов двигателя

После полной остановки двигателя

возможен новый запуск

Если превышение произошло из-за
неправильного переключения передач с
с высшей на низшую: проверьте двигатель;
если двигатель в порядке, вы можете запустить двигатель
и продолжать движение.
Если двигатель самопроизвольно увеличил
обороты, не запускайте двигатель!
Срочно обратитесь в сервисный центр!

Ошибка сигнала скорости
автомобиль

нмакс = 1550 об/мин

Проверить подключение тахографа к электронному блоку управления
.
Вы можете продолжать движение.
Обратитесь в сервисный центр.

Избыток переносимых по воздуху
стрессов

Проверить зарядку
аккумулятора.

Неправильно закончен
рабочий цикл электронного
блока управления

Данная ошибка появляется из-за
отключения массы раньше 5с после
выключения зажигания или прерывания
питания электронного блока управления.
Вы можете продолжать движение.
Обратитесь в сервисный центр

Неисправность линии CAN

Проверить подключение линии CAN к
другим устройствам CAN
(ABS, АКПП и т.д.).
Вы можете продолжать движение.
Обратитесь в сервисный центр

Многие из нас сталкивались с такой проблемой, как включение индикации значка двигателя (Check engine…), появление которого пугает водителей автомобилей. Вот 5 самых распространенных причин, почему на приборной панели загорается чек двигателя.

Значок датчика двигателя обычно появляется без предупреждения. Причину появления Check engine сразу понять невозможно. Даже если в автомобиле есть автодиагностика (например, в таких автомобилях, как , ), которая сканирует все системы автомобиля на наличие ошибок и, если таковые имеются, выводит расшифровку на информационное табло, причины появления неисправности проверка двигателя не будет расшифрована.

Для большинства водителей появление данного предупреждающего символа на панели приборов означает, что им необходимо срочно обратиться в автосервис для диагностики и устранения причины, по которой появился предупреждающий знак проверки двигателя. Но на самом деле в большинстве случаев при появлении индикации «Проверить» можно, а в некоторых случаях, возможно, устранить причину самостоятельно без поездки в автосервис, что сэкономит ваши деньги.

1. Заменить кислородный датчик (лямбда-зонд)

Датчик кислорода в вашем автомобиле является частью выхлопной системы выхлопных газов, которая контролирует, сколько кислорода не сгорает в камере сгорания двигателя. Этот датчик помогает контролировать расход топлива автомобиля. Неисправный кислородный датчик (лямбда-зонд) означает, что компьютер автомобиля получает неверные данные, что может значительно увеличить расход топлива и снизить мощность двигателя. Большинство автомобилей имеют от 2 до 4 кислородных датчиков. Если у вас есть домашний сканер ошибок автомобиля, то, подключив его к автомобилю, вы без труда узнаете, какой датчик нуждается в замене.

По какой причине кислородный датчик в автомобиле приходит в негодность: Со временем датчик покрывается слоем отработанного и моторного масла(маслосодержащего нагара), что снижает точность считывания показаний датчика для регулирования состава бензиновой смеси и распределить оптимальную.Неисправность кислородного датчика в автомобиле приводит не только к , но и к повышенному содержанию вредных веществ СО2 в выхлопе.

Что нужно сделать: Если не поменять неисправный автомобильный датчик кислорода, это может привести к выходу из строя катализатора в вашем автомобиле (может лопнуть), что повлечет за собой дорогостоящий ремонт. Стоимость новых катализаторов очень высока из-за содержания в них драгоценных сплавов. На некоторых автомобилях катализаторов несколько, стоимость которых может доходить до 90 000 рублей.Так что не затягивайте с заменой датчика. Хоть замена датчика и его стоимость не очень маленькая, но она несоизмерима со стоимостью системы нейтрализатора отработавших газов. Вы также можете сэкономить на стоимости замены, сделав это самостоятельно. Во многих руководствах по эксплуатации автомобилей есть подробные инструкции, как заменить кислородный датчик самостоятельно. Если вы знаете, где находится кислородный датчик, то вам не составит труда отсоединить неисправный «лямбда-зонд» и заменить его на новый. Не забудьте вытащить с заменой этот важный элемент, который вы не сможете вытащить!

2.Проверить крышку топливного бака


Многие водители в большинстве случаев при появлении индикации “check engine” задумаются о серьезных проблемах в двигателе автомобиля, но даже не подумают проверить герметичность топливной системы, которая может быть нарушена из-за дефекта или недостаточно затянута крышка заливной горловины топливного бака. Это очень частая причина появления значка «Проверить» двигатель.

Причина ошибки: Негерметичность топливной системы из-за прохождения воздуха, пробка заливной горловины, увеличит расход топлива автомобиля, на что система диагностики автомобиля выдаст ошибку двигателя, включив Индикация «Check engine» на приборной панели автомобиля.

Что нужно сделать: Если при появлении индикации “Проверить” Ваш автомобиль не потерял мощность, и отсутствуют звуковые признаки повреждения двигателя (стук в двигателе, гул, скрип и т.д.), то в первую очередь проверьте герметичность бензобака. Возможно, крышка бензобака треснула или недостаточно плотно затянута. Если крышка была недостаточно затянута, то, затянув ее до упора, продолжайте некоторое время ездить на автомобиле, чтобы посмотреть, исчезнет ли ошибка двигателя. Чтобы предотвратить появление чека двигателя по этой причине, регулярно проверяйте крышку заливной горловины. Помните, что периодически крышку необходимо заменять новой!

3.

Катализатор выхлопных газов автомобиля


Автомобильный катализатор помогает автомобилю сделать выхлопные газы двигателя более экологичными. Он превращает угарный газ и другие вредные вещества в безвредные соединения. Если у вас пришел в негодность катализатор выхлопных газов, вы заметите это не только при появлении значка двигателя (чек), но и задолго до этого, когда мощность автомобиля упадет в 2 раза.Например, при нажатии на педаль газа у автомобиля, как и прежде, не будет хорошей динамики разгона.

Из-за чего может выйти из строя автомобильный катализатор: если вы регулярно обслуживаете свой автомобиль, в соответствии с регламентом обслуживания автофирмы, то катализатор не должен выходить из строя. Основной причиной выхода из строя катализатора является несвоевременная замена неисправного кислородного датчика, а также нерегулярная замена свечей зажигания по истечении срока годности.При неисправности кислородного датчика или свечей зажигания прекращается превращение угарного газа в катализаторе в безвредные химические элементы, что приводит к перегреву катализатора, который в результате может выйти из строя.

Что нужно сделать: Если у вас пришел в негодность катализатор, то вы не сможете управлять автомобилем, так как двигатель будет работать некорректно, предупреждая об этом индикацией на приборной панели со значком двигателя (чек). Также у вас сильно возрастет расход топлива, и не будет тяги двигателя.Хоть замена катализатора и очень дорогой ремонт, но от ремонта никуда не деться. Хотя альтернатива замене катализатора на пламегаситель есть, но это не 100-процентный вариант. К сожалению, если вы не опытный автомеханик, то заменить неисправный катализатор выхлопных газов самостоятельно вы не сможете. В любом случае придется обратиться в автосервис. Помните, что своевременная замена лямбда-зондов и свечей зажигания защищает ваш катализатор от повреждений!

4.Замените датчик массового расхода воздуха

.


Датчик массового расхода воздуха регулирует, сколько воздуха необходимо добавить в бензиновую смесь для оптимального воспламенения топлива. Датчик постоянно информирует компьютер автомобиля о количестве подаваемого кислорода. Неисправный датчик MAF приведет к увеличению расхода топлива, повышению уровня CO2 в выхлопных газах, снижению мощности двигателя и плавности хода. Также при неисправном датчике наблюдается плохая динамика разгона. В морозы машина с неисправным датчиком плохо заводится.

Причины выхода из строя ДМРВ: Большинство отказов датчика происходит из-за неправильной установки воздушного фильтра при его плановой замене. Также, если регулярно не менять воздушный фильтр, как того требует регламент обслуживания автомобиля, рекомендованный заводом-изготовителем, датчик массового расхода воздуха может выйти из строя.

Что нужно сделать: По идее с неисправным датчиком массового расхода воздуха можно ездить долго (несколько недель или месяцев).Но вы заметите, что чем дольше вы едете, тем больше увеличивается расход топлива. Замена датчика в автосервисе стоит не так дорого, так как сама работа не занимает много времени и достаточно проста. Основные затраты связаны со стоимостью датчика, которая для некоторых моделей автомобилей может составлять 11 000-14 000 рублей, если это оригинальный датчик или до 6 000 рублей, если это аналог-заменитель. Самостоятельная замена датчика очень проста. Но в связи с низкой стоимостью замены датчика можно доверить эту работу мастеру в автосервисе. Помните, что необходимо регулярно менять воздушный фильтр, соблюдая правила эксплуатации автомобиля!

5. Замена свечей зажигания и высоковольтных проводов


Свечи зажигания в автомобиле являются основными деталями для воспламенения топливной смеси. При неисправных свечах зажигания неправильно подается искра для воспламенения бензиновой смеси. Дефектные свечи зажигания часто имеют отсутствие искры или неправильный интервал зажигания, что влияет на неисправность двигателя.Если свечи зажигания не работают должным образом во время разгона, особенно с места, вы можете почувствовать небольшие толчки.

Каковы причины выхода из строя свечей зажигания: Большинство свечей зажигания в автомобилях до 1996 года нуждаются в замене каждые 25 000-30 000 км пробега. В более новых автомобилях свечи зажигания служат более 150 000 км. Однако это время замены свечей зажигания может быть сокращено за счет различных факторов, связанных с качеством топлива и стилем вождения.

Что нужно сделать: Если у вас давно не менялись свечи, или если вы чувствуете провалы, связанные с зажиганием в двигателе, то необходимо сразу заменить их на новые без промедления.Не пытайтесь сэкономить на несвоевременной замене свечей зажигания, так как стоимость свечей не очень дорогая, как и работа по их замене. Замена старых свечей зажигания улучшит работу двигателя и снизит расход топлива автомобиля. Самостоятельно поменять свечи зажигания несложно. В основном они легко доступны под капотом автомобиля. Вам понадобится обычный свечной ключ, чтобы снять свечи зажигания с двигателя. Также желательно следить за состоянием высоковольтных проводов, так как со временем они могут прийти в негодность и пропускать электричество, которое передается на свечи зажигания, что снизит силу искры. Помните, что регулярная замена свечей зажигания, в соответствии с графиком технического обслуживания вашего автомобиля, предохраняет катализатор выхлопных газов от повреждений, а также улучшает работу двигателя!

Коды ошибок

на КамАЗ Евро-4 являются информацией о неисправностях автомобиля.

Как проводится диагностика?

Диагностика включает в себя сбор признаков неисправностей в системе, сканирование электронной системы управления, сброс и проверку всех механизмов и систем на наличие неисправностей в электронном блоке, осмотр всех датчиков, отвечающих за бесперебойную работу силового агрегата.

При диагностике КамАЗ-5490, 54115, 5308 и других моделей с двигателем, изготовленным по международным экологическим стандартам Евро-3 и 4, измеряют уровень давления в топливной системе, проверяют работоспособность генераторной установки и анализируют выхлопные газы с помощью специального оборудования. Также проверяют обмотку электромагнитного регулятора системы подачи топлива и КЗ в катушках индуктивных датчиков.

Оборудование и программное обеспечение для диагностики

Есть несколько сканеров для выявления проблем в механизмах автомобиля, например:

  1. Автосканер ДК-5.Данное оборудование помогает выявлять неисправности в работе электронного блока путем считывания и корректировки показателей системы управления с помощью компьютера. Данный автосканер можно использовать при температуре до +30°С и относительной влажности воздуха не более 80%.
  2. Сканер
  3. ЭДС-24. Это аппаратно-программный комплекс, предназначенный для компьютерной диагностики грузового автомобиля. Он включает гальванически изолированный USB-адаптер, который позволяет тестировать системы в условиях низкого напряжения.

Диагностические программы:

  • Евроскан;
  • Сканматик-2;
  • АВТОАС-КАРГО.


Ошибки декодирования

Расшифровка кодов ошибок КамАЗ представлена ​​в инструкции к программе, которая используется для диагностики. Примеры ошибок:

  • 213 – неисправность устройства управления силовым агрегатом;
  • 296 – упало давление масляной жидкости;
  • 2973 – неисправности в системе регулирования давления воздуха во впускном коллекторе;
  • 214 – перегрев масляной жидкости;
  • 235 – недостаточное количество охлаждающей жидкости в системе;
  • 425 – высокая температура масла;
  • 3617 – нет сигнала многоступенчатого переключателя;
  • ошибка 4335 – проблемы с подачей воздуха;
  • 275 – неправильно работает ТНВД;
  • 429 – показания высокого напряжения в цепи указателя уровня топлива;
  • 351 – нарушение в работе форсунок;
  • 415 – низкий уровень рабочей жидкости;
  • 261 – перегрев топлива.

См. » Все о ремонте и установке крана тормозного КамАЗ


Сломанные датчики

Коды неисправностей датчиков КамАЗ-34334, 6308 и других моделей с двигателем Евро-4:

  • 221 – поломка датчика положения педали, отвечающего за подачу рабочей жидкости;
  • 232 – неисправность датчика, измеряющего атмосферное давление;
  • 335 – дефекты проводки выходного каскада управления лампами;
  • 231 – неисправность датчика давления наддува на ЭБУ;
  • 124 – исправление некорректного индикатора напряжения;
  • 345 – некорректная работа передачи сигнала от указателя давления ОГ;
  • 113 – проблемы с частотой вращения распредвала;
  • 112 – некорректные показатели, поступающие на блок управления от коленчатого вала;
  • 246 – неисправности датчика температуры;
  • 00550 – неисправность заглушки ТНВД.


Неисправности двигателя внутреннего сгорания

Список поломок ДВС на КамАЗе:

  • 726 FMI 2 – неисправности в работе указателя положения устройства, отвечающего за распределение жидкости;
  • СПН 526313 ФМИ 6 – брак устройства, контролирующего уровень давления в механизме рампы;
  • SPN 520211 FMI 12 – нет сообщения от системы АБС;
  • SPN 791 FMI 4 – низкий уровень заряда;
  • 523470-2 – нет напряжения в цепи механизма, отвечающего за сброс показателей давления;
  • СПН 523613 FMI 16 – изношены фильтры очистки рабочей жидкости;
  • 77 FMI 0 – двигатель с высокими оборотами;
  • 190-3 – неисправность;
  • 110-0 – высокий уровень температуры двигателя;
  • 132-4 – сбой в распределении воздушного потока;
  • 653-0 – повреждение в системе питания форсунок.


Прочие поломки

Кодовая таблица:

Коды системных ошибок Причина поломки
СПН 977 ФМИ 4 Неисправность цепи механизма кондиционера
98-1 Превышено число оборотов коленчатого вала
523601-4 Низкий уровень топлива и масла
3514-31 Блок питания вышел из строя
675-4 Закрытые сопла
13688-4 Реле топливного насоса замкнуто на массу
91-4 Нечеткий сигнал датчика, отвечающего за положение тормозного механизма
171-3 Эта ошибка означает неисправность термометра.
1072-4 Клапан закорочен на массу
111-3 Сильный сигнал от указателя уровня антифриза
1188-5 Нет связи с реле подогрева воздушного потока
110-2 Датчик, следящий за температурой антифриза, работает некорректно
1188-4 Замыкание на массу в цепи управления клапаном давления

АБС имеет встроенную самодиагностику, система постоянно контролирует собственную работоспособность.Для принудительной функциональной проверки в целях устранения неполадок необходимо использовать режим принудительной диагностики.

Включение электронного блока в режим принудительной диагностики осуществляется нажатием и удержанием в течение 1 – 2 секунд кнопки диагностики АБС (см. рис. Щиток приборов) при включенных массе и выключателе стартера и приборов (блокировка ротор необходимо повернуть ключом в положение «I».

В этом случае, если перед входом в режим диагностики горела диагностическая лампа (что свидетельствует о наличии активных ошибок, т.е. ошибки или неисправности, присутствующие на момент диагностики), затем при нажатии на кнопку гаснет примерно на 1 секунду, а затем циклически повторяющийся активный код ошибки каждые 4 секунды до устранения данной неисправности.

Мигающий световой код активной ошибки о характере неисправности и неисправном элементе системы состоит из двух информационных блоков, представляющих собой два блока световых вспышек. Продолжительность каждой вспышки 0,5 секунды, пауза между вспышками 0.5 секунд, между блоками – 1,5 секунды. Неисправный элемент и характер неисправности определяют по количеству вспышек диагностической лампы соответственно в первом и втором блоках по таблице Световые коды состояния элементов АБС. При отсутствии отказов или неисправностей выдается световой код 1-1 (по одному миганию контрольной лампы в каждом информационном блоке). Если активных ошибок в системе несколько, то после устранения первой ошибки будет выдан световой код второй активной ошибки и т.д.(до устранения всех неисправностей).

После устранения всех активных ошибок необходимо повернуть ротор блокировки ключом в выключателе стартера и приборов ключом сначала в положение «0», а затем в положение «I».

Если активных ошибок нет, то в режиме диагностики последовательно (каждые 4 секунды) выдаются световые коды последних 4-х пассивных или “плавающих” ошибок. ошибки, которые были, но на момент диагностики отсутствуют (или остались не стертыми в памяти блока).Информация о пассивных ошибках отображается 1 раз. Для повторного вывода светового кода пассивных ошибок необходимо повторно нажать кнопку диагностики, как описано выше.

КамАЗ 65115. Режим системы управления АБС

В системном режиме можно определить конфигурацию системы, последние четыре (пассивные) ошибки были стерты из памяти электронного блока и выполнена перенастройка системы.

Для включения системного режима нажмите кнопку диагностики (см. рис. Панель приборов) и удерживайте ее в течение 3.от 0 до 6,3 секунды. При активации системного режима автоматически стираются все пассивные ошибки, если они были в памяти блока. Об этом будет свидетельствовать 8 быстрых (длительностью 0,1 секунды) вспышек диагностической лампы. При наличии активных ошибок указанных вспышек не последует, а код конфигурации будет выдан сразу.

Световой код конфигурации выдается после включения системного режима (на автомобилях КамАЗ установлена ​​система 4S/4M 4 датчика/4 модулятора), количество вспышек лампы должно быть равно 2 (две световые вспышки 0.длительностью 5 секунд с паузой 1,5 секунды). Код конфигурации повторяется каждые 4 секунды. Для выхода из системного режима необходимо выключить, а затем включить блокировку стартера и переключателя приборов в положение «приборы» или нажать кнопку диагностики на время от 6,3 до 15 секунд. При этом вывод световых кодов на диагностическую лампу прекращается.

Если стереть код неисправности сложно (после многократного повторения операций стирания сохраняется один и тот же код), необходимо еще раз убедиться в устранении соответствующей неисправности и повторять операции до получения кода 1-1.

Световые коды состояния элементов АБС

Ра – РБ
1 – 1 Все элементы в хорошем рабочем состоянии.
2 – 1
2 – 2
2 – 3
2 – 4
Модулятор B
Модулятор A
Модулятор D
Модулятор C
Обрыв или короткое замыкание на массу.

Обрыв или короткое замыкание на массу.
Обрыв или короткое замыкание на массу.

Проверьте соединительные кабели, подключение к блоку и модулятору.
Устранение повреждений.
Если повреждений нет, замените модулятор.
3 – 1
3 – 2
3 – 3
3 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Большой воздушный зазор
Большой воздушный зазор
Большой воздушный зазор
Большой воздушный зазор
Отрегулируйте зазор между датчиком и ротором.
Максимальный зазор равен 1.3 мм.
4 – 1
4 – 2
4 – 3
4 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Короткое замыкание или обрыв

Короткое замыкание или обрыв
Короткое замыкание или обрыв

Проверить датчик, соединение с блоком и датчик, кабель датчика
на обрыв или короткое замыкание. Устранять.
Замените датчик.
5 – 1
5 – 2
5 – 3
5 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Прерывистый сигнал
Прерывистый сигнал
Прерывистый сигнал
Прерывистый сигнал
Проверить кабель и уровень сигнала датчика при вращении колес

Проверить целостность ротора.

6 – 1
6 – 2
6 – 3
6 – 4
Датчик B
Датчик A
Датчик D
Датчик C
Неисправный ротор/датчик
Неисправный ротор/датчик
Неисправный ротор/датчик
Неисправный ротор/датчик
Замените датчик или ротор.
7 – 1 Связь с БУ Ошибка связи Проверьте проводку. Устраните неисправность
(см.Принципиальная схема подключения АБС).
Проверить блок управления, при неисправности заменить.
7 – 3 Реле вспомогательного тормоза Проверить кабель реле на обрыв или короткое замыкание. Устранять.
Проверьте работоспособность реле.
7 – 4 Лампа диагностики АБС Короткое замыкание или обрыв Проверить кабель лампы на обрыв или короткое замыкание. Устранять.
Убедитесь, что лампа работает правильно.
8 – 1 БУ блок питания Пониженное напряжение бортовой сети Проверьте аккумуляторы и предохранители. Обеспечить напряжение 24-28В
(см. рис. Принципиальная схема подключения АБС).
8 – 2 БУ блок питания Перенапряжение бортовой сети Проверить реле напряжения бортовой сети.
Замените при необходимости.
8 – 3 БУ Внутренняя ошибка Заменить БУ
8 – 4 БУ Ошибка конфигурации Заменить БУ
8 – 5 БУ блок питания Ошибка подключения массы Проверьте правильность подключения.Устранить неисправность

Поиск и устранение неисправностей

Причиной неисправности тормозной системы может быть отказ в работе пневматических устройств, нарушение регулировок, а также утечка сжатого воздуха в пневмопривод из-за негерметичности соединений трубопроводов и гибких шлангов. Утечки в цепях пневмопривода сигнализируются люминесцентными сигнальными лампами (см. рис. Панель приборов и блоки контрольных ламп) и зуммером. Когда давление в контурах превышает 450-550 кПа (4.5-5,5 кгс/см2), лампы должны погаснуть, и одновременно должен перестать звучать зуммер. Время заполнения ресиверов сжатым воздухом до номинального давления не должно превышать 8 мин при номинальной частоте вращения двигателя.

Проверить герметичность пневмопривода при номинальном давлении, включенных потребителях сжатого воздуха и неработающем двигателе. Найдите крупные утечки воздуха на слух. Незначительные утечки можно обнаружить, покрыв соединения трубопроводов мыльной эмульсией.

При поиске неисправностей использовать Схемы пневмопривода тормозных систем, , на котором условно изображены тормоза и соединяющие их трубопроводы.

Пневматические тормозные системы одиночных автомобилей КАМАЗ моделей 53229, 55111, 6511 5

1 – водоотделитель;
2 – компрессор;
3 – охладитель;

6 – регулятор давления;

8 – кран тормозной;

14 – манометр;

16 – приемник контура IV
17 – приемник контура II;
18 – клапан слива конденсата;

20.24 – клапаны ускорительные;

23 – приемники III контура;
25 – приемник контура I;

28 – модуляторы АБС;
29 – Датчик скорости АБС;

Пневматическая тормозная система автомобилей КАМАЗ моделей 55111, 65115 работающая с прицепом

1 – водоотделитель;
2 – компрессор;
3 – охладитель;
4 – Клапан предохранительный четырехконтурный;
5 – автоматический регулятор тормозных усилий;
6 – регулятор давления;
7 – выключатель тормозного сигнала;
8 – кран тормозной;
9 – пневмоцилиндры привода заслонки вспомогательной тормозной системы;
10 – кран управления стояночным тормозом;
11 – клапан пропорциональный;
12 – пневмоцилиндр привода рычага остановки двигателя;
13 – кран управления вспомогательной тормозной системой;
14 – манометр;
15 – передняя тормозная камера;
16 – приемник контура IV;
17 – приемник контура II;
18 – клапан слива конденсата;
19 – задняя тормозная камера;
20, 24 – клапаны ускорительные;
21 – клапан перепускной двухлинейный;
22 – выключатель контрольной лампы стояночной тормозной системы;
23 – ресиверы III контура;
25 – приемник контура I;
26 – выключатель контрольной лампы падения давления воздуха в контуре III;
27 – клапан аварийного сброса;
28 – модуляторы АБС;
29 – Датчик скорости АБС;
30 – влагомаслоотделитель с регулятором давления;
31 – кран управления тормозами прицепа;
32 – головки автоматические соединительные;
А, В, С, D – клапаны управляющих выходов.

Серьезный автомобиль ведет себя неадекватно? Капризы вашего грузовика могут разрушить деловые соглашения и привести к длительному простою, опустошив ваш кошелек. В этой статье мы покажем вам, как диагностировать проблемы на ранней стадии, чтобы вы могли начать устранять проблемы как можно раньше.

[Скрыть]

Электронные системы управления КАМАЗ

В последнее время двигатели Камского автозавода стали классифицировать по принадлежности к тому или иному классу экологичности (от Евро-0 до Евро-4).Техническая реализация класса Евро-3, а затем Евро-4, принятого с 2013 года, оказалась невозможной без использования электронных систем управления двигателем (ЭСУД). Именно это привело к возможности производить с использованием универсальных.

Различные комплектации Автомобили КАМАЗ оснащались двигателями с электронными блоками управления (ЭБУ). И если сейчас водителя беспокоит нездоровое поведение при эксплуатации известных грузовиков, появились симптомы в виде плавающих оборотов, потери тяги, посторонних шумов, повышенного расхода солярки, на помощь приходит самодиагностика.

С помощью вывода информации с ЭБУ в виде кода ошибки можно указать точную диагностику электрооборудования КАМАЗ. Процесс диагностики и расшифровки кодов зависит от типа электронной системы, установленной на грузовике. Перед началом диагностики предлагается определить тип ЭБУ по установленной модели двигателя.


Самодиагностика Независимо от того, какой фирмой изготовлен ваш V8, Cammins Inc. (Камминз) или ООО КАМАЗ, системы подачи топлива от «Common rail» и системы рециркуляции отработавших газов (EGR) или системы нейтрализации (SCR), будет проведена диагностика в соответствии с этими двумя типами.

Процесс самодиагностики электронных систем КАМАЗ двигателей Евро-3, -4 несколько отличается от аналогичной процедуры на других автомобилях. После нажатия определенной кнопки один из сигнализаторов или блок начнет мигать с разной периодичностью, количество вспышек лампы одного интервала определяет разряд кода.

Двигатель с ЭБУ BOSCH MS 6.1

Итак, устраиваемся в кабине нашего КАМАЗа, далее включаем зажигание поворотом ключа как обычно. Вместе со многими другими индикаторами загорается контрольная лампа диагностики или «Check Engin», в простонародье — ПЛ. Лампа загорается на 3 секунды и гаснет, тем самым демонстрируя свою работоспособность и исправность ЭБУ. Если лампа не гаснет или загорается при работающем двигателе, обнаружена неисправность электронной системы!


Обратите внимание на качельку режима диагностики (часто устанавливается на панели приборов слева, под рулем) или кнопку этого режима (часто находится рядом с блоком предохранителей, под панелью напротив сиденья пассажира) .Балансир имеет два крайних положения удержания и центральное фиксированное положение.

Опускаем качельку в крайнее верхнее или нижнее положение и удерживаем там более двух секунд. Просто нажмите кнопку и не отпускайте указанное выше время. После того, как «качелька» или кнопка вернется обратно, диагностическая лампа будет мигать сначала с длинными интервалами, а потом с короткими. Количество длинных вспышек определяет первый бит кода ошибки, количество коротких – второй бит.


На схеме показан пример получения кода 24.Соотносим код ошибки (иначе, блинк-код, от англ. blink – моргать) с приведенной ниже таблицей.

Коды ошибок ЭБУ BOSCH MS6.1 двигателей эко-класса Евро-3
Код ошибки Описание неисправности Ограничения работы, установленные ЭБУ
11 педаль газа скорость двигателя ограничена
1900 об/мин
12, 13 датчик атмосферного давления без ограничений
14 датчик сцепления скорость двигателя ограничена
1900 об/мин
15 датчик частоты вращения коленчатого вала частота вращения двигателя ограничена
1600 об/мин
16, 17 Неправильная полярность датчиков частоты вращения
датчики установлены неправильно
обороты двигателя ограничены
1800 об/мин
18 датчик частоты вращения распределительного вала частота вращения двигателя ограничена
1800 об/мин
19 главное реле без ограничений
21, 22, 24-26 Топливный насос высокого давления Ошибка запуска двигателя
23 несоответствующее положение педалей газа и тормоза не ограничено
27 плохой контакт датчика положения рейки отказ запуска двигателя
28 датчик педали тормоза не ограничено
29, 51-53, 81-86, 99 электронный блок управления отказ запуска двигателя
31, 32 датчик температуры воздуха без ограничений
33, 34 датчик давления воздуха без ограничений
35 Модуль круиз-контроля без ограничений
36, 37 Датчик температуры жидкостного охлаждения Обороты двигателя ограничены
1900 об/мин
38, 39 Датчик температуры топлива Обороты двигателя ограничены
1900 об/мин
41 сигнал с многоступенчатого входа не соответствует эталону не ограничено
42 превышена максимальная скорость двигателя возможно, была выбрана неправильная передача. Сброс ошибки
при повторном запуске двигателя
43 ошибка сигнала скорости частота вращения двигателя ограничена
1500 об/мин
54 превышение бортового напряжения не ограничено
55 цикл работы блока управления не завершен корректно не ограничено
61-67 Линия CAN без ограничений

Нередко компьютер регистрирует несколько ошибок, для просмотра следующего кода повторите вышеописанные действия кнопкой или “качелькой”.Коды ошибок будут воспроизводиться циклически. В памяти ЭБУ фиксируется не более пяти неисправностей. Для удаления всех ошибок из памяти блока управления необходимо включить зажигание и удерживать «качельку» в течение пяти секунд. Таким образом можно временно избавить автомобиль от тревожных симптомов в виде электронных ограничений.

Двигатель с ЭБУ ISB CM2150


Данный тип ЭБУ устанавливался на более поздние модели КАМАЗ и диагностика в этом случае будет отличаться от приведенной схемы. После включения зажигания в память электронного блока записывается действующая на данный момент неисправность, кроме того неисправность может сигнализироваться красной или желтой контрольной диагностической лампой.


После нажатия на «качельку» в любом крайнем положении более двух секунд будет выдан код неисправности с полусекундным интервалом между вспышками одной из двух ламп. Цифры кода ошибки разделены двухсекундной паузой. В отличие от ЭБУ предыдущего типа, результирующий код будет трех- или четырехзначным!

Соотносим код ошибки с таблицей ниже.Цвет линий в таблице соотносится с цветом контрольной диагностической лампы. Красный цвет индикации указывает на невозможность начать или продолжить движение при данной неисправности, желтый цвет указывает на необходимость устранения неисправности после окончания движения на автомобиле.

Коды ошибок ЭБУ ISB CM2150 для двигателей эко-класса Евро-3
111 Критическая неисправность внутри модуля управления двигателем – интеллектуально-программируемая часть или ее компонент работает некорректно 422 Уровень охлаждающей жидкости – Получены ошибки 689 Ошибка датчика первичной частоты вращения двигателя – приходят ошибки
115 Потеря пары сигналов электромагнитного датчика в цепи датчика частоты вращения (положения) двигателя – получены ошибки 425 Температура смазки двигателя — получены неверные данные 1139 Цилиндр форсунки №1 – механическая система работает неправильно или не отрегулирована
143 Низкое давление масла – вероятно, но ниже оптимального рабочего диапазона 428 Вода в цепи датчика топлива – напряжение выше нормы, либо цепь замкнута на источник высокого напряжения 1141 Цилиндр форсунки №2 – механическая система работает неправильно или не отрегулирована
146 Температура охлаждающей жидкости выше нормы — хорошо, но выше оптимального рабочего диапазона 429 Попадание воды в цепь датчика топлива – напряжение выше нормы, либо цепь замкнута на источник низкого напряжения 1142 Цилиндр форсунки №3 – механическая система работает неправильно или не отрегулирована
151 Температура охлаждающей жидкости ниже нормы — хорошо, но выше оптимального рабочего диапазона 431 Цепь проверки холостого хода, педаль акселератора или рычаг – получены ошибочные данные 1143 Цилиндр форсунки №4 – механическая система работает неправильно или не отрегулирована
197 Уровень охлаждающей жидкости — действителен, но ниже оптимального рабочего диапазона 432 Цепь проверки работы на холостом ходу, педали акселератора или рычага – не откалибрована 1144 Цилиндр форсунки № 5 — механическая система неисправна или не отрегулирована
214 Температура моторного масла – хорошая, но выше оптимального рабочего диапазона 433 Цепь датчика давления во впускном коллекторе – получены неверные значения 1145 Цилиндр форсунки № 6 — механическая система неисправна или не отрегулирована
233 Давление охлаждающей жидкости — допустимое, но ниже оптимального рабочего диапазона — умеренно тяжелое 434 Сбой питания без выключения зажигания (Ignition Off) – получены ошибки 2265 Сигнальная цепь управления пусковым насосом – напряжение выше нормативного, либо замыкание на источник высокого напряжения
234 Высокие обороты двигателя – хорошие данные, но выше оптимального рабочего диапазона 435 Цепь – приходят ошибки 2266 Сигнальная цепь управления насосом проворачивания коленчатого вала – напряжение ниже нормы или короткое замыкание на источник низкого напряжения
235 Недостаточное количество охлаждающей жидкости — допустимо, но ниже оптимального рабочего диапазона 441 Низкое напряжение батареи № 1 — допустимо, но ниже оптимального рабочего диапазона 2292 Устройство учета топлива – достоверные данные, но выше оптимального рабочего диапазона
245 Цепь управления вентилятором — слишком низкое напряжение или короткое замыкание на низкое напряжение 442 Аккумулятор № 1, высокое напряжение — хорошее, но выше оптимального рабочего диапазона 2293 Устройство дозирования топлива — Требуемый расход ниже ожидаемого — Действительно, но ниже оптимального рабочего диапазона
261 Температура топлива в двигателе – достоверная, но выше оптимальных условий эксплуатации 449 Высокое давление топлива – хорошее, но выше оптимального рабочего диапазона 2377 Цепь управления вентилятором – напряжение выше нормы или короткое замыкание на источник высокого напряжения
275 Элемент впрыска топлива (передний) – механическая система работает неправильно или не отрегулирована 595 Турбокомпрессор № 1, высокая скорость — действителен, но выше оптимального рабочего диапазона 2555 Цепь нагревателя впускного воздуха №1 – напряжение выше нормы или короткое замыкание на источник высокого напряжения
281 Клапан №1 соленоид высокого давления, управляемый топливом – механическая система работает неправильно или не отрегулирована 596 Зарядка Электрическое высокое напряжение — хорошее, но выше оптимального рабочего диапазона 2556 Цепь подогревателя впускного воздуха №1 – напряжение ниже нормы или короткое замыкание на источник низкого напряжения
351 Источник питания форсунки – неисправность (интеллектуально программируемое) устройство или компонент 598 Низкое электрическое напряжение зарядки — допустимо, но ниже оптимального рабочего диапазона 2558 Вспомогательный ШИМ (широтно-импульсная модуляция) № 1 Триггер — слишком низкое напряжение или короткое замыкание на низкое напряжение
415 Низкое давление масла — допустимо, но ниже оптимального рабочего диапазона 687 Низкая скорость турбонагнетателя № 1 — действительна, но ниже оптимального рабочего диапазона 2973 Цепь датчика давления во впускном коллекторе – получены неверные данные

Если вы не нашли в таблице марку вашего двигателя или код ошибки ЭБУ ISB CM2150, обязательно напишите нам, и мы сразу же постараемся помочь.

Реконструкция истории происхождения и траекторий дифференцировки отдельных раковых клеток в миелопролиферативных новообразованиях

Выделение мононуклеарных клеток

Мононуклеарные клетки (МНК) выделяли из BMA с помощью протокола центрифугирования в градиенте плотности с использованием системы SepMate компании StemCell Technologies, Inc. BMA, фосфатно-солевой буфер (PBS) с 2% эмбриональной бычьей сыворотки (PBS + 2% FBS; StemCell Technologies, Inc. № 07905), Lymphoprep (StemCell Technologies, Inc.№ 07801) и центрифугу (Eppendorf № 5810R) акклиматизировали при комнатной температуре. Приблизительно 20–22 мл Lymphoprep добавляли в пробирку SepMate объемом 50 мл (StemCell Technologies, Inc. № 15450), осторожно пипетируя ее через центральное отверстие вставки SepMate, следя за тем, чтобы присутствовало как можно меньше пузырьков воздуха. BMA разбавляли равным объемом PBS + 2% FBS и осторожно перемешивали пипеткой с широким отверстием. Удерживая пробирку SepMate вертикально, разбавленный образец добавляли, медленно пипетируя его по стенке пробирки. Разбавленный BMW центрифугировали при 1200 x g в течение 20 минут при комнатной температуре с выключенным тормозом. Для BMA, богатого тромбоцитами/плазмой, верхний слой тромбоцитов/плазмы удаляли пипеткой. Оставшийся объем до центрального отверстия SepMate (содержащий все обогащенные МНК) переливали в новую пробирку объемом 50 мл. МНК промывали, добавляя до 45 мл PBS + 2% FBS и хорошо перемешивая пипеткой с широким отверстием. Затем МНК центрифугировали при 300 x g в течение 12 минут при комнатной температуре с низким тормозом и удаляли надосадочную жидкость.В осадок MNC снова добавляли PBS + 2% FBS, и объем хорошо перемешивали пипеткой с широким отверстием. Центрифугировать при 120 x g в течение 12 минут при комнатной температуре с выключенным тормозом. Затем супернатант удаляли. Для БМА, богатой тромбоцитами, проводили дополнительную промывку и центрифугирование в течение 12 минут при комнатной температуре с перерывом. Осадок MNC ресуспендировали в 1 мл буфера EasySep (StemCell Technologies, Inc. № 20144) и смешивали пипеткой с широким отверстием. Концентрацию клеток подсчитывали с помощью гемоцитометра (Reichert) и системы Tali Image Cytometer (ThermoFisher #{“type”:”entrez-нуклеотид”,”attrs”:{“text”:”T10796″,”term_id”:”3” ,”term_text”:”T10796″}}T10796) с использованием слайдов для анализа изображений Tali (ThermoFisher #{“type”:”entrez-нуклеотид”,”attrs”:{“text”:”T10794″,”term_id”:”3 “,”term_text”:”T10794″}}T10794).Клетки помещали на лед до дальнейшего использования.

Обогащение CD34+

МНК CD34+ выделяли с использованием протокола EasySep Human CD34 Positive Selection Kit II (StemCell Technologies, Inc. #17856). МНК (в концентрации > 10 8 клеток/мл буфера EasySep) добавляли в полистироловую круглодонную пробирку объемом 5 мл (12 × 75 мм) (StemCell Technologies, Inc. № 38007). Добавляли коктейль EasySep Human CD34 Positive Selection (StemCell Technologies, Inc. № 17856C) в концентрации 100 мкл на 1 мл образца. Затем образец перемешивали и инкубировали при комнатной температуре в течение 10 минут. EasySep Dextran RapidSpheres (StemCell Technologies, Inc. № 50100) встряхивали в течение 30 с. Добавляли RapidSpheres в концентрации 75 мкл на 1 мл образца. Образец перемешивали и инкубировали при комнатной температуре в течение 5 минут. В пробирку налили до 2,5 мл буфера EasySep и осторожно перемешали. Пробирку помещали в магнит EasySep (StemCell Technologies, Inc. № 18000) и инкубировали при комнатной температуре в течение 3 минут.Супернатант удаляли, переворачивая магнит с пробиркой внутри. Этот процесс повторяли еще 4 раза, всего 5 раундов обогащения. Клетки ресуспендировали в PBS + 2% FBS после последнего раунда обогащения. Концентрацию клеток подсчитывали с помощью гемоцитометра (Reichert #1492) и цитометра Tali Image. Клетки помещали на лед до дальнейшего использования. CD34+ MNC использовали для создания библиотек одноклеточных кДНК, одноклеточных РНК-Seq (scRNA-seq) и библиотек ампликонов JAK2 , как описано ниже.

Локус-специфические библиотеки ампликонов одиночных клеток

Мы разработали следующий протокол для преимущественной амплификации транскриптов, содержащих интересующие локусы, из библиотек кДНК одиночных клеток (например, JAK2 -V617F), тем самым создавая локус-специфические одноклеточные библиотеки клеточных ампликонов (рис. S1A–S1C).

Для амплификации транскриптов, несущих интересующие локусы, из библиотек одноклеточных кДНК с высокой чувствительностью и специфичностью использовали подход с тройной вложенной ПЦР.В этом подходе использовались локус-специфические обратные праймеры, которые фланкируют сайт мутации, в сочетании с общими прямыми праймерами, которые сохраняют структуру штрих-кодирования одной клетки. В общей сложности было проведено 5 этапов ПЦР (3 вложенных этапа, которые постепенно отфильтровывали определенный транскрипт, 1 этап, на котором добавлялась последовательность Read2, и 1 этап, на котором добавлялась последовательность адаптера Illumina P7). На этапе 1 проводили ПЦР с использованием прямого праймера, содержащего как последовательность Illumina P5, так и часть последовательности Read 1, и обратного праймера, содержащего локус-специфическую последовательность примерно на 300 п.н. выше сайта мутации.На этапе 2 проводили ПЦР с использованием укороченной версии прямого праймера на этапе 1 и обратного праймера, содержащего локус-специфическую последовательность примерно на 150 п.н. выше сайта мутации. На этапе 3 проводили ПЦР с использованием прямого праймера из этапа 2 и обратного праймера, содержащего локус-специфическую последовательность примерно на 50 п.н. выше сайта мутации. На этапе 4 проводили ПЦР с использованием прямого праймера из этапа 2 и обратного праймера, содержащего часть локус-специфичной последовательности, использованной на этапе 3, в сочетании с последовательностью Read2.На этапе 5 проводили ПЦР с использованием прямого праймера, использованного на этапе 1, и обратного праймера, содержащего последовательность Read2 в сочетании с последовательностью Illumina P7.

Ниже приведен специальный протокол, использованный для создания библиотек ампликонов JAK2 -V617F. Все ПЦР проводили в пробирках TempAssure PCR (USA Scientific #14024700) на термоциклере Bio-Rad C1000 Touch.

На этапе 1 была приготовлена ​​смесь для ПЦР объемом 25 мкл, содержащая 12,5 мкл мастер-микса для амплификации (10x Genomics # 220125), 1.25 мкл добавки кДНК (10x Genomics #220067), 1,25 мкл прямого праймера (P5-Partial Read 1, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC) в концентрации 20 мкм, 1,25 мкл обратного праймера (Reverse Ext 1, ACCAACCTCACCAACATTACAGAGGCCT) в концентрации 10 мкм, библиотечный материал и 3 нг кДНК. оставшийся объем водой без нуклеаз. При установленной на крышке термоциклера температуре 105°С используется следующий протокол термоциклирования: начальная денатурация при 98°С в течение 45 с, 10 циклов денатурации при 98°С в течение 20 с, отжиг при 67°С в течение 30 с, удлинение при 72°С в течение 180 с и окончательное удлинение при 72°С в течение 60 с.

Реакционную смесь для ПЦР очищали с использованием SPRIselect (Beckman Coulter #{“type”:”entrez-нуклеотид”,”attrs”:{“text”:”B23318″,”term_id”:”2508949″,”term_text”: “B23318”}}B23318) следующим образом. К реакционной смеси добавляли 20 мкл (т. е. 0,8x) реагента SPRIselect, перемешивали пипеткой и инкубировали при комнатной температуре в течение 5 минут. Пробирку для ПЦР помещали в магнитный сепаратор 10x (10x Genomics # 230003) на высокой мощности до тех пор, пока раствор не станет прозрачным (обычно около минуты). Супернатант удаляли и выбрасывали.К осадку добавляли 200 мкл 80% этанола в воде, не содержащей нуклеаз, и оставляли на 30 с. Промывку этанолом удаляли и повторяли еще раз. Пробирку для ПЦР ненадолго центрифугировали и снова помещали в магнит при низкой настройке. Любую оставшуюся промывку этанолом удаляли, и осадку давали высохнуть на воздухе в течение 1 минуты. Затем ДНК элюировали, удаляя пробирку для ПЦР с магнита, пипетируя 20 мкл буфера EB (QIAGEN # 19086) на осадок, перемешивая пипеткой, позволяя смеси уравновеситься в течение 2 минут, помещая пробирку на магнит на низком уровне, а затем элюирование жидкости в новую пробирку.

На этапе 2 была приготовлена ​​смесь для ПЦР объемом 25 мкл, содержащая 12,5 мкл мастер-микса для амплификации (10x Genomics #220125), 1,25 мкл добавки кДНК (10x Genomics #220067), 1,25 мкл прямого праймера (Partial P5, AATGATACGGCGACCACCGAGATCT) в 20 мкМ, 1,25 мкл обратного праймера (Reverse Ext 2, AGGAGACTACGGTCAACTGCATGAAACAGA) в концентрации 10 мкМ, 5 мкл продукта ДНК, полученного на этапе 1, и 3,75 мкл воды без нуклеазы. При установленной на крышке термоциклера температуре 105°С используется следующий протокол термоциклирования: начальная денатурация при 98°С в течение 45 с, 10 циклов денатурации при 98°С в течение 20 с, отжиг при 67°С в течение 30 с, удлинение при 72°С в течение 180 с и окончательное удлинение при 72°С в течение 60 с.Реакционную смесь ПЦР очищали с использованием SPRIselect (0,8x), как описано ранее.

На этапе 3 была приготовлена ​​25 мкл смеси для ПЦР, содержащей 12,5 мкл Hot Start Taq 2x Master Mix (NEB #M0496S), 1,25 мкл добавки кДНК (10x Genomics #220067), 1,25 мкл прямого праймера (Partial P5, AATGATACGGCGACCACCGAGATCT ) в концентрации 20 мкМ, 1,25 мкл обратного праймера (Reverse Ext 3, GCAGCAAGTATGATGAGCAAGCTTTCTCACA) в концентрации 10 мкМ, 5 мкл продукта ДНК, полученного на этапе 2, и 3,75 мкл воды без нуклеазы. При температуре крышки термоциклера, установленной на 105°С, используется следующий протокол термоциклирования: начальная денатурация при 95°С в течение 30 с, 10 циклов денатурации при 95°С в течение 30 с, отжиг при 60°С в течение 60 с, удлинение при 68°С в течение 210 с и окончательное удлинение при 68°С в течение 300 с.Реакционную смесь ПЦР очищали с использованием SPRIselect (0,8x), как описано ранее.

На этапе 4 была приготовлена ​​25 мкл смеси для ПЦР, содержащей 12,5 мкл мастер-микса для амплификации (10x Genomics #220125), 1,25 мкл добавки кДНК (10x Genomics #220067), 1,25 мкл прямого праймера (Partial P5, AATGATACGGCGACCACCGAGATCT) в 20 мкМ, 1,25 мкл обратного праймера (Partial Reverse Ext 3-Read 2, GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAGCAAGTATGATGAGCA) в концентрации 10 мкМ, 2 мкл продукта ДНК, полученного на этапе 3, и 6,75 мкл воды, свободной от нуклеаз.При установленной на крышке термоциклера температуре 105°С используется следующий протокол термоциклирования: начальная денатурация при 98°С в течение 45 с, 10 циклов денатурации при 98°С в течение 20 с, отжиг при 67°С в течение 30 с, удлинение при 72°С в течение 195 с и окончательное удлинение при 72°С в течение 60 с. Реакционную смесь ПЦР очищали с использованием SPRIselect (0,8x), как описано ранее.

На этапе 5 была приготовлена ​​смесь для ПЦР объемом 25 мкл, содержащая 12,5 мкл мастер-микса для амплификации (10x Genomics # 220125), 0,5 мкл праймера для SI-PCR (10x Genomics # 220111), 2.5 мкл из одной лунки (записано для дальнейшего использования) из индексной пластины для образцов Chromium i7 (10x Genomics # 220103), 2 мкл продукта ДНК, полученного на этапе 4, и 7,5 мкл воды без нуклеазы. При температуре крышки термоциклера, установленной на 105°С, используется следующий протокол термоциклирования: начальная денатурация при 98°С в течение 45 с, 10 циклов денатурации при 98°С в течение 20 с, отжиг при 54°С в течение 30 с, удлинение при 72°С в течение 195 с и окончательное удлинение при 72°С в течение 60 с. Реакционную смесь ПЦР очищали с использованием SPRIselect (0.8x), как описано выше.

Контроль качества на каждом этапе был проверен с использованием High Sensitivity D5000 ScreenTape (Agilent № 5067-5592) и High Sensitivity D5000 ScreenTape (Agilent № 5067-5593) в системе Agilent 2200 Tapestation (рис.  S1E). Библиотеки ампликонов отображают несколько пиков на трассе TapeStation (рисунок S1E), что, как полагают, связано с бессистемным связыванием праймеров с поли-А-подобными областями. Успешное обогащение правильным продуктом ДНК обычно ассоциировалось с «пилообразными» следами.После использования разных индексирующих праймеров на этапе 5 для разных библиотек несколько библиотек были объединены и последовательно секвенированы вместе на секвенаторе Illumina Novaseq 6000. Настройки цикла секвенирования были следующими: 28 циклов для чтения 1, 8 циклов для индекса i7 и 91 цикл для чтения 2. Материал кДНК

, полученный на этапе создания библиотеки одноклеточной кДНК, описанном в предыдущем разделе, в целом был адекватным. для создания описанных здесь библиотек ампликонов.Если требовалась дополнительная кДНК, библиотеку кДНК одиночных клеток амплифицировали путем повторения шага 2.2 руководства пользователя Chromium Single Cell 3′ Reagent Kit v3 (10x Genomics, {“type”:”entrez-нуклеотид”,”attrs”:{ “text”:”CG000183″,”term_id”:”33868831″,”term_text”:”CG000183″}}CG000183 Rev A).

В зависимости от целевой мутации для сведения к минимуму неспецифического связывания праймеров требовалась оптимизация расположения локус-специфических праймеров и их биохимических свойств. Для мутации JAK2 -V617F три используемых локус-специфических праймера имели длину ~30 п.н. и температуру плавления около 68°C.Поскольку количество циклов ПЦР зависит от уровня экспрессии гена, содержащего целевые мутации, количество циклов было экспериментально оптимизировано для других мишеней мутаций (например, TET2 ).

Генотипирование стволовых клеток и подготовка к WGS

Несколько типов клеток были генотипированы и подготовлены для WGS: (1) HSCs, MPPs и стромальные клетки из биопсии костного мозга и (2) фибробласты из биопсии кожи.

1. ГСК, МПП и стромальные клетки

10 мл аспиратов костного мозга использовали для выделения ГСК, МПП и стромальных клеток.Эритроциты удаляли из 9 мл образцов аспирата костного мозга с использованием буфера для лизиса эритроцитов. Обогащение CD34 проводили с использованием магнитной сортировки клеток с использованием магнитных шариков против CD34 (Miltenyi Biotech #130-046-703). Различные клеточные популяции очищали с использованием FACSAria (Becton Dickinson). Для определения клеточных популяций использовали следующие комбинации маркеров клеточной поверхности. HSC: CD34+CD38-CD45RA-CD90+CD49f+; МПП: CD34+CD38-CD45RA-CD90-CD49f-.

Сначала клетки сортировали в пробирку для сбора, а второй этап сортировки по индексу выполняли для посева одиночных клеток в круглодонные 384-луночные планшеты с ~90 мкл питательной среды.Колонии выращивали в среде StemSpan SFEM (StemCell Technologies, Inc. #09650) с добавлением: SCF (100 нг/мл), Flt3-L (100 нг/мл), TPO (50 нг/мл), IL3 (10 нг/мл). мл), Tpo (50 нг/мл), Epo (10 нг/мл) и GM-CSF (10 нг/мл). Колонии выращивали при 37°C в 5% CO 2 в течение 4-6 недель перед сбором, с частичной заменой среды и пополнением свежими цитокинами каждые 2 недели.

Культуры поликлональных мезенхимальных стволовых клеток (МСК) получали из 1 мл образцов аспирата цельного костного мозга после лизиса эритроцитов, клетки высевали в чашки, обработанные тканевыми культурами, в среде DMEM-F12 (GIBCO #11320082), с добавлением 10% фетального бычья сыворотка (VWR № 89510-186). МСК хранили в культуре в течение недели, и каждый день меняли среду для удаления неприлипших клеток. Стромальные клетки были готовы к сбору после достижения 80–100% слияния.

2. Биопсия кожи

Один образец биопсии кожи был получен от пациента с мутацией JAK2 V617L. Ткань диссоциировали с использованием коллагеназы I (StemCell Technologies, Inc. #07415) и экстрагировали геномную ДНК, как описано ниже.

Для обоих образцов геномную ДНК экстрагировали из клеток с использованием микронаборов QIAmp UCP DNA Micro Kits (QIAGEN #56204) и элюировали до конечного объема 30 мкл.Концентрацию ДНК определяли количественно с помощью флуорометра Qubit (Invitrogen #{“type”:”entrez-protein”,”attrs”:{“text”:”Q32866″,”term_id”:”75280873″,”term_text”:”Q32866 “}}Q32866) и набор для анализа двуцепочечной ДНК Qubit HS (Invitrogen #32854). Некоторую часть геномной ДНК (1 нг) амплифицировали с использованием специфичных праймеров JAK2 -V617F и подвергали скринингу на мутацию с помощью секвенирования по Сэнгеру.

Чтобы получить продукты ПЦР для целевых локусов JAK2 для секвенирования по Сэнгеру, мы провели три раунда вложенной ПЦР с локус-специфичными обратными праймерами и общими прямыми праймерами.Сначала был амплифицирован фрагмент JAK2 длиной 611 п.н. для получения достаточного количества ДНК, содержащей сайт мутации. Компоненты ПЦР включали 1 нг матрицы гДНК, Phusion Hot Start Flex 2x Master Mix (M0536L), прямой и обратный праймеры ACTCTTGCTCTCTCTCACTTTG и ACCTGCCATAATCTCTTTTGCT (олигонуклеотиды ДНК, синтезированные IDT) соответственно и воду, не содержащую нуклеаз. Протокол амплификации был следующим: 1) начальная денатурация при 98°С в течение 30 с; 2) 40 циклов денатурации при 98°С в течение 10 с; 3 – отжиг при 63°С в течение 30 с; 4 – удлинение при 72°С в течение 30 с; и (5) окончательное удлинение при 72°C в течение 10 минут.Реакционные смеси ПЦР медленно пропускали на 1,5% агарозном геле в ЭДТА. Продукты ПЦР экстрагировали из геля с использованием набора Monarch DNA Gel Extraction Kit (NEB T1020L).

Во-вторых, продукты ПЦР секвенировали по Сэнгеру в четырех отдельных реакциях (каждая с одним из четырех праймеров) с помощью службы секвенирования гДНК Psomagen. Четыре используемых праймера фланкировали сайт мутации в обоих направлениях (олигонуклеотиды ДНК, синтезированные IDT):

  • 1.

    TGGCAGAGAGAATTTTCTGAAC (147 п.н. выше мутации)

  • 2.

    ACTCTTGCTCTCTCTCACTTTG (304bp выше по потоку от мутации)

  • 3. GTCCTACAGTGTTTTCAGTTTCA (166bp ниже по потоку от мутации)

  • 4. ACCTGCCATAATCTCTTTTGCT (306bp ниже по потоку от мутации)

электрофореграммы из Sanger секвенирования были аннотированы. Образец клеток помечали как вероятно имеющий мутацию, если все соответствующие электрофореграммы для этого образца содержали мутацию.Затем отбирали образцы, и их гДНК подвергали секвенированию WGS (Broad Genomics). Результаты секвенирования WGS всегда соответствовали секвенированию по Сэнгеру, то есть мутация JAK2 была обнаружена в данных полногеномного секвенирования для колоний, которые были определены как мутировавшие с помощью секвенирования по Сэнгеру.

Из примерно 600 MPP и примерно 600 HSC, культивированных из ET 1, мы восстановили достаточное количество геномной ДНК из 62 колоний MPP и 22 колоний HSC после размножения. Из них 6 колоний MPP и 16 колоний HSC имели мутацию JAK2 -V617F, что указывает на то, что мутированные HSC пролиферировали больше в наших условиях культивирования по сравнению с HSC дикого типа.Подобная систематическая ошибка также наблюдалась в клетках, культивированных у пациента ET 2. 384 колонии HSC и 384 колонии MPP были культивированы у пациента ET 2. Из них мы экстрагировали достаточное количество геномной ДНК из 44 колоний HSC и 84 колоний MPP. Генотипирование по Сэнгеру показало, что 14 из 44 колоний HSC и 2 из 84 колоний MPP имели гетерозиготную мутацию JAK2 -V617F. Общая глубина секвенирования составила 1,6 миллиарда прочтений для ET 1 и 480 миллионов прочтений для ET 2., 2016), алгоритм, который определяет размер популяции, умноженный на постоянный коэффициент из деревьев родословных, где постоянным фактором является время между поколениями. BNPR предполагает гауссовский процесс, предшествующий клональной экспансии, и делает вывод о предельном апостериорном распределении размера популяции (умноженном на постоянный коэффициент) в разные моменты времени из времени слияния дерева. Чтобы сделать вывод о динамике популяции с помощью BNPR, мы использовали пакет Phylodyn (Karcher et al., 2017).

Для дерева пациентов 34 лет мы использовали алгоритм усреднения (алгоритм усреднения описан в разделах ABC), чтобы длина от любого листа до корня дерева была одинаковой.Затем мы преобразовали длины ветвей из мутаций в поколения, предполагая 1 клеточное деление в год (Abkowitz et al., 1996; Catlin et al., 2011), чтобы мы могли сделать вывод о размере популяции без постоянного фактора. Время слияния дерева было передано в BNPR в качестве входных данных. Единственный параметр, который мы установили, был lengthout = 28, который определяет количество временных срезов, на которых оценивается размер популяции, а остальные были параметрами по умолчанию. Вывод BNPR для 63-летнего пациента был сделан аналогичным образом.

Вывод BNPR не был чувствителен к выбранным нами априорным значениям. В частности, изменение ковариации, связанной с гауссовским процессом, не изменило интерпретации результатов. Мы также протестировали BNPR на смоделированных клональных экспансиях при различных сценариях, включая простой экспоненциальный рост и узкие места популяции, и надежно определили размер популяции с течением времени.

Вывод пригодности HSC мутанта JAK2

Чтобы более точно сделать вывод о клональной экспансии мутантных HSC, мы провели ABC (аппроксимированное байесовское вычисление) с использованием модели Райта-Фишера с отбором (подробное описание ABC см. в Методах S1, моделирования, а также для симуляций, которые показывают, что наш вывод устойчив к предположениям модели).

Для каждого дерева пациентов мы запустили наш алгоритм ABC и определили параметры модели.

Для пациента в возрасте 34 лет мы использовали следующие спецификации для ABC:

  • 1.

    s было взято из равномерного распределения на (0, 2).

  • 2.

    N получено из 10 X , где X равномерно распределено по (1, 9).

  • 3.

    L было взято из раунда ( Y ), где Y является гауссианой со средним значением 35 и стандартным значением 5.Если L  < 2, мы перерисовываем L до L > = 2, поскольку для создания дерева необходимо как минимум 2 поколения.

  • 4

  • 4.

    G было нарисовано равномерно на 2, …, Л.

  • 5.

    K

    K = 22 клетки были проб

  • 6.

    Уровень мутации было (общая длина дерева пациентов в мутациях)/( L – 1). В этом случае общая длина дерева пациентов в мутациях составила 723.

  • 7.

    Был использован порог эпсилон 0,0225.

Для пациента в возрасте 63 лет мы использовали следующие спецификации для ABC:

  • 1.

    s было взято из равномерного распределения на (0, 2).

  • 2.

    N получено из 10 X , где X равномерно распределено по (1, 9).

  • 3.

    L было взято из раунда ( Y ), где Y является гауссианой со средним значением 65 и стандартным значением 10.Если L  < 2, мы перерисовываем L до L > = 2, поскольку для создания дерева необходимо как минимум 2 поколения.

  • 4.

    G было сделано равномерно на 2, …, Л.

  • 5.

    K

    K = 13 клетки были проб

  • 6.

    Уровень мутации было (общая длина дерева пациентов в мутациях)/( L – 1). В этом случае общая длина дерева пациентов в мутациях составила 1205.

  • 7.

    Был использован порог эпсилон 0,0125.

Обратите внимание, что мы нарисовали s из (0, 2) вместо (0, 5), как это сделано на смоделированных данных в Методах S1. Это было сделано для ускорения моделирования и оправдано, поскольку предварительные прогоны показали, что распределение s сходится к гораздо меньшему значению.

Для каждого пациента мы провели 400 параллельных симуляций. Для 34-летнего человека мы собрали 1 038 712 точек данных сзади, а для 63-летнего человека мы собрали 8 816 199 точек данных сзади.Заднее распределение суставов показано на D и на рисунке S4.

Как показал наш анализ (см. Методы S1), пригодность s можно вывести из деревьев пациентов. Наш анализ также показывает, что, если мы предположим, что скорость деления составляет один раз в год (Lee-Six et al., 2018), n можно вывести для 34-летнего пациента как 4,74 ± 0,68 апостериорного распределения. n , однако, нельзя вывести для 63-летнего пациента, и предполагаемое распределение n является лишь предварительной информацией.Это связано с тем, что события слияния происходят в очень ранней истории болезни, и информация о размере популяции теряется. Однако мы можем установить границы точки насыщения, если допустим одно деление в год. Как видно из результатов моделирования, представленных в методах S1, когда количество мутантных клеток приближается к N , рост мутантной популяции замедляется и начинает проявлять нейтральную динамику. Если N достаточно мало, коалесцентная структура изменяется, и ABC предполагает, что точка насыщения равна n = N .Траектории, сгенерированные ABC, если N ниже определенного порогового значения, давали коалесцентные структуры, которые не соответствовали данным пациента. Любое значение 93 205 N 93 206, превышающее этот порог, не влияло на коалесцентную структуру и поэтому было сохранено как возможное предполагаемое значение. Поэтому N точно определить не удалось.

Denso Corporation – Портал автомобильной промышленности MarkLines

— крупный поставщик автозапчастей в Toyota Group.

– Из общего объема продаж автомобильной продукции в финансовом году, закончившемся в марте 2021 года, продажи Toyota Group (включая Daihatsu и Hino) составили 57% от общего объема.

– Компания в основном работает в пяти секторах бизнеса: тепловые системы, системы трансмиссии, системы мобильности, системы электрификации, а также датчики и полупроводники. Основные продукты каждого из этих секторов бизнеса описаны ниже.

Категория Подкатегория Продукты
Тепловые системы Для легковых автомобилей -HVAC
-Компрессоры
-Системы кондиционирования воздуха для сидений
-Накрышные циркуляционные насосы
-Модули охлаждения двигателя
-Конденсаторы
-Радиаторы
-Системы впуска (радиаторы) насосы
Для коммерческого транспорта – Системы кондиционирования воздуха для автобусов и сельскохозяйственной техники
– Холодильные системы для грузовых автомобилей
Системы трансмиссии Для коммерческого транспорта и сельскохозяйственной техники – Системы Common Rail
– Рядные и распределительные ТНВД
– Форсунки
– Топливные фильтры
– Форсунки селективной каталитической нейтрализации мочевины (SCR)
Для легковых автомобилей – Портовые форсунки
– Форсунки прямого впрыска
– Насосы прямого впрыска
– Катушки зажигания
– Свечи зажигания
– Свечи накаливания
– Магниты
– Компьютеры управления двигателями мотоциклов
Выхлопные системы – Датчики выхлопных газов
– Датчики температуры выхлопных газов
– Основной материал, используемый в системах очистки выхлопных газов
Компоненты мехатроники -Продукция для секторов CASE: приводы с электронным управлением, многопозиционные клапаны
-Испарительные изделия: испарительные обратные модули
-Регулируемые клапаны: регулируемые фазорегуляторы, масляные регулирующие клапаны, электрические кулачково-фазовые клапаны
-Привод -изделия управления: модули АКПП, соленоиды АКПП
-Продукты впуска и выпуска: (клапаны EGR, дроссельные заслонки
-Датчики: расходомеры воздуха, модули педали газа
-Модули топливного насоса
-Фильтры: воздушные очистители масляных фильтров
Системы мобильности Электроника -ЭБУ для управления силовыми агрегатами
-ЭБУ для управления органами
Системы кабины – Блоки управления HMI
– Центральные информационные дисплеи
– Комбинированные счетчики
– Проекционные дисплеи (HUD)
Подключенные системы – Блоки управления телематики
– Бортовые устройства ETC
– Устройства предупреждения о выходе из полосы движения и приближении транспортных средств
АД&АДАС – Радарные системы миллиметрового диапазона
– Лазерные радарные системы
– Датчики изображения
– Сонарные датчики и ЭБУ
– ЭБУ монитора
– ЭБУ автономного вождения
– ЭБУ локатора
– ЭБУ управления фарами
– Датчики и ЭБУ подушек безопасности
– Водитель -устройства контроля
Звук – Устройства предупреждения о приближении к транспортным средствам
– Зуммеры
Системы электрификации Электронные компоненты -Стартеры
-Генераторы
-Статоры MG
-ISG
Компоненты электрификации – Инверторы
– Преобразователи DC/DC
– Блоки контроля аккумуляторов
– ЭБУ аккумуляторов
– Блоки литий-ионных аккумуляторов
– Высоковольтные реле
Компоненты управления шасси – Системы рулевого управления с электроусилителем со встроенным двухсистемным приводом
– ЭБУ рулевого управления с электроусилителем
– ЭБУ торможения
Двигатели – Стеклоочистители
– Стеклоомыватели
– Электродвигатели стеклоподъемников – Электродвигатели сидений
– Электродвигатели управления двигателем
– Электродвигатели вентилятора
– Электродвигатель вентилятора
Датчики и полупроводники Датчики – Полупроводниковые датчики: датчики давления, электрические и магнитные датчики потока, оптические датчики, датчики температуры
Полупроводники -ИС специального назначения
-Модули питания: платы питания, контроллеры двигателей

Продукты

Система кондиционирования воздуха

HVAC Unit
-COA HVAC
-Rear HVAC
– Vavorator
-Heater Core
-Servo модуль
-Servo мотор
-Blower вентилятор
-Blower Motor
-блокировки

тепловой насос Система кондиционирования воздуха
– Электрический компрессор с функцией впрыска газа
– Наружный теплообменник
– Компактный газожидкостный сепаратор со встроенным клапаном
– Электрический расширительный клапан
– Конденсатор кабины
– Электронный блок управления тепловым насосом

Продукты системы управления
– Воздух -Электронный блок управления кондиционером
-Электронный блок управления тепловым насосом
-Датчик наружной температуры/датчик температуры в салоне
-Датчик влажности
-Датчик солнечной активности
-Датчик выхлопных газов
-Матричный ИК-датчик
-Реле давления
-Датчик давления хладагента

Теплообменник для системы кондиционирования воздуха
– Испаритель
– Испаритель системы эжекторного цикла
– Холодильная камера Испаритель
-Heater Core
-Condenser
-Водный охлажденный конденсатор
-Cabin Condenser
-Outside теплообменник
-Double Tipe Type Внутренний теплообменник

Изделия хладагента
-Fixed смещение компрессора
-Variable компрессор
Компрессор с функцией впрыска газа
– Электрический компрессор
– Расширительный клапан
– Электронный расширительный клапан
– Электромагнитный клапан
– Компактный газожидкостный сепаратор со встроенным клапаном
– Ресивер
– Аккумулятор

Водяной насос – Электрический5
– Высоковольтный водонагреватель

Система кондиционирования воздуха для автобусов
– Кондиционер для автобусов
– Кондиционер для электрических автобусов


Морозильная камера для автомобилей
– Морозильная камера для грузовиков
– Морозильная камера для электрических грузовиков

 

Системы трансмиссии

Системы впуска воздуха
— Клапан рециркуляции отработавших газов (EGR)
— Клапанный блок EGR
— Электронный корпус дроссельной заслонки
— Электронный корпус дизельной дроссельной заслонки
— Регулируемый впускной клапан управления подачей воздуха
— Электрический привод перепускного клапана
— Измеритель расхода воздуха 1 – Датчик температуры воздуха на впуске
– Датчик давления воздуха на впуске

Системы впрыска топлива и управления
– ЭБУ управления двигателем
– Форсунка впрыска топлива в порт
– Форсунка высокого давления прямого впрыска
-G4S-i Электромагнитная форсунка
-G4P-i Пьезофорсунка
– Насос высокого давления прямого впрыска
– Насос подачи HP5S
– Датчик давления топлива
– Датчик положения коленчатого вала (тип MRE)
– Датчик положения распредвала (тип MRE)
– Направляющая
– Топливный фильтр

Системы зажигания
– Катушка зажигания
– Иридиевая свеча зажигания
– Датчик детонации (нерезонансного типа)

Системы выхлопных газов
– Кислородный датчик
– Датчик температуры выхлопных газов
– Датчик соотношения воздух-топливо
– Датчик давления выхлопных газов
– Встроенный датчик NOx-A/F
– Датчик температуры газа EGR
– Подложка
– Турбодвигатель регулируемой форсунки
– ЭБУ системы доочистки

Системы клапанного механизма
– Электрическая регулировка фаз газораспределения
– Встроенная регулировка фаз газораспределения
– Регулировка фаз газораспределения
– Клапан управления потоком масла
– Датчик положения кулачка (тип MRE)

Топливные системы
– Модуль проверки на утечку паров топлива18 – 9000 Клапан закрытия адсорбера
– Рабочий регулирующий клапан
– Клапан удержания паров
– Датчик уровня топлива
– Датчик давления в баке
– Контроллер топливного насоса
– Топливный насос
– Модуль топливного насоса

Системы заправки топливом
– Электронный блок управления заправкой водородом
– Инфракрасный передатчик

Системы охлаждения
– Радиатор
– Электрический вентилятор
– Резервный бак
– Промежуточный охладитель с водяным охлаждением 9 0018 -Multi-Flow Class Rock
-2-х датчик температуры

продукты начнется
-starter
-TAndem соленоид (TS) стартер

продукты генерации
-Alternator
-Hight напряжение ISG

Блок питания
– Блок управления электроприводом
– Электронный блок управления литий-ионной батареей
– Блок контроля батареи
– Блок литиевой батареи
– Датчик тока батареи

Продукция подстанции
– Инвертор
– Преобразователь DC-03

Статор генератора двигателя

Приводные системы
– Переключение с помощью троса привода
– Модуль корпуса клапана
– Автоматическая коробка передач линейного типа Соленоид
– Модуль педали акселератора
– Датчик скорости автомобиля
– Блок управления коробкой передач 20 Системы впрыска топлива и управления для автомобилей среднего и большого размера
– Форсунка G4S
– Rai l
– Насос подачи HP6
– Насос подачи HP7
– Топливный фильтр

Другие продукты
– Звуковой сигнал
– Power Mini ISO реле
– Комбинированный датчик давления и температуры моторного масла
– Реле уровня моторного масла
– Датчик наклона
-Акустическая система оповещения транспортных средств

  

Системы безопасности и кокпита

Системы распознавания условий вождения
— Радиолокационный датчик миллиметрового диапазона
— Субмиллиметровый радарный датчик
— Лазерный радар
— Стереодатчик обзора
— Датчик сонара
— Датчик обзора
— ЭБУ сонара Датчик технического зрения

Системы динамического контроля автомобиля
-ЭБУ DSS
-ЭБУ 4WD
-Датчик крутящего момента на рулевом колесе
-Датчик давления усилителя тормозов
-Датчик давления тормозной жидкости
-Датчик скорости вращения колеса
-Датчик инерции для ESC
-Accelerometer для Подвеска
– Электродвигатель рулевого управления с усилителем
– Электродвигатель системы противоскольжения

Системы безопасности при столкновении
– ЭБУ подушек безопасности
– ЭБУ подушек безопасности для компактных автомобилей
– Электронный спутниковый датчик подушек безопасности
– Акселерометр для системы подушек безопасности
– Спутниковый датчик бокового давления Система подушек безопасности
– Датчик присутствия пассажира
– Датчик обнаружения столкновения с пешеходом
– Датчик присутствия пассажира ce ЭБУ/датчик
– Приемник системы контроля давления в шинах

Системы поддержки обзора
– ЭБУ цифрового наружного зеркала заднего вида
– Датчик дождя
– Датчик освещенности
– Система омывателя
– Система переднего стеклоочистителя
– Система заднего стеклоочистителя – Шаговый двигатель 9001 для корректора фар
– Шаговый двигатель поворотного устройства фар
– Насос очистителя фар

Информационные системы кабины
-11. 6-дюймовый сенсорный дисплей
– Проекционный дисплей
– Комбинация приборов
– Панель климат-контроля
– Дистанционный сенсорный контроллер
– Телематический блок управления DCM (модуль передачи данных)
– Бортовое оборудование для связи V2X
– Электронная плата за проезд Система сбора данных и бортовое оборудование ETC2.0
– Антенна VICS
– Монитор состояния водителя

Системы защиты информации
– Электронный блок управления центральным шлюзом
– Электронный блок управления Smart

Другие продукты
– Электронное управление кузовом Блок
– Смарт-брелок
– Передатчик дистанционного управления системой доступа без ключа
– Приемник системы дистанционного управления системой бесключевого доступа
– Ключ со смарт-картой
– Датчик касания
– Двигатель сиденья с электроприводом
– Двигатель телескопического рулевого управления
– Двигатель наклона рулевого управления
– Электродвигатель люка
– Электродвигатель сдвижной двери
– Электродвигатель доводчика
– Электродвигатель стеклоподъемника

.

Добавить комментарий

Ваш адрес email не будет опубликован.